Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig2603
Length(NT) : 735
Best Gene Model Blast : Link to GSTUMT00008448001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_04264
Accession: ref|XP_001594457.1| Score: 338 E_value: 4e-30
KEGG Definition: hypothetical protein
Accession: ncr:NCU09326.1 Score: 304 E_value: 2e-26
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4701 Score: 118 E_value: 3e-07
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 120 E_value: 2e-07
Swissprot: P53189|SCW11_YEAST
Gene Ontology:
GO:0009277 = Cellular component: fungal-type cell wall
GO:0005515 = Molecular function: protein binding
GO:0007109 = Biological process: cytokinesis, completion of separation

Sequence:
>Contig2603
GTTACTACCAGCAAGGTTGTCCTGACCACCTATGTCTGCCCCACGGCTGG
TACCTACACTATTGGTGCTTCAACCACCACTGTAACCGGAACCGTCACTG
TCCCTTGCACGTACCCAGTCCCAACCGCATATCCTCCTGGAACCTACACC
CATCCTGAGGTCGTTACCACCGTTACTGTCACCAGTGCCGTTGTTGTTTG
CCCTTACACCACTAAGGGACTCCCTACTTCGGCCCCGGGTGCCCATACCA
CCACCCCTCTGCCTCCTGCTAGCACTGTCTCGGCCACTTCCGTTGCTTCA
TCTGTTGCTCCAACCACCACCCCGTTGGCTCCTTCTAGCACCGCCTCCGC
CACCCCCGTCTCTTCATCTTCTGCTCCATCGAGCTCTGCTACCAGCAAGC
CGGTATCTGGCGGTGGTCTTTGGGCTATTACCTACTCGCCATACACCGCC
AATGGTGGTTGTAAGACCGCTTCTGAGGTCTCTGCAGACATTACCAGTAT
TGCTTCTAAGGGATTTCAGAACATCCGTCTATACTCCACTGACTGTGATG
GTCTCAAGAACGTTGGATCTGCTTGCGAGGCTAATGGTGTTGGTATCATT
CTCGGTGTCTTCATCAAGGCCGGCGGTGTCTCCACTGCTGATGAGCAGGT
TAAGGATATCCTTGAATGGAAGAAGTTTGAATTGGTTGTTCTCTTTGTTG
TCGGTAATGAGGCTGTCTTCAATGGATTCTGCACT

Sequences in the Contig:

SY0AAB34YP21FM1 SY0AAC52YI23FM1