Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig2572
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00010039001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: DnaJ domain protein
Accession: ref|XP_001258226.1| Score: 707 E_value: 7e-73
KEGG Definition: hypothetical protein
Accession: fgr:FG09767.1 Score: 682 E_value: 3e-70
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1150 Score: 335 E_value: 2e-32
PFAM Definition: DnaJ, DnaJ domain. DnaJ domains (J-domains) are associated with hsp70 heat-shock system and it is thought that this domain mediates the interaction. DnaJ-domain is therefore part of a chaperone (protein folding) system. The T-antigens, although not in Prosite are confirmed as DnaJ containing domains from literature..
Pfam Number: pfam00226 Score: 147 E_value: 1e-10
Swissprot: O74746|SPF31_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig2572
TTGGACAACATGTCAGAAGAGGACACAGCGGTCGATAAGGACATCCTAGC
GGAGCTAGATAGGGAAGCATCTGATTACCTCAAGGATGCCGAAATATCTC
GAATCTTAAATGCTTTCAAATTAGATGCCTACGCAATCCTAGACCTAAAA
CCCGGCGTCCCAGAATCCGACATCAAGCTCCAATTCCGCCGCAAATCCCT
CCTTATCCACCCGGACAAGACTAAGAACCCGCAAGCCCCCGATGCCTTCG
ACCGTCTCAAAAAAGCACAGGGCGTGCTCATGGACGAGAAGGCGCGCACC
CGTCTGGATGAAGCGATCGCCGACGCGCGCATGCTACTCATCCGCGAGAA
GAAGTGGACCGTGGATAATCCAGAACTCACCGGCGAGGAATTCGCCGTGG
AGTGGCGGGAGAAGACCAAGTTTGTCCTGATCGAGAGCGAGTTGAGGAGG
AGGAAGCAGGTCAAGGCGCAGATGGCCGAGGAAGGGAGGGAGAAGAGGAA
GGCGGATGAGGAGGTTGAAGCGCGGAAGAGGAAGCGGGAGAATGAGATTG
CCTGGGAGGAGACTAGGGATCAAAGAATTAATAGCTGGAGGGATTTTAAG
AAGGGAGAAGAGAAGAAGAAGAAGAAGAAGGCCAAGCCCCTGGGATGAAA
CTCTTTCCCCTTTTCCTATTTCTTTTCCTTTTCCTTTTCCTTTTTTTTTT
TCT

Sequences in the Contig:

SY0AAB20YA12FM1 SY0AAB33YJ17FM1 SY0AAB35YC03FM1
SY0AAB37YE06FM1 SY0AAB39YF06FM1 SY0AAC28YB22FM1
SY0AAC30YB05FM1