Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig2556
Length(NT) : 646
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 1e-133
Numbers of ESTs : 2

Blast Results:

Nr Definition: heat shock protein 82
Accession: ref|XP_001216617.1| Score: 735 E_value: 3e-76
KEGG Definition: molecular chaperone (HSP90 family); K04079 molecular chaperone HtpG
Accession: aor:AO090102000620 Score: 733 E_value: 3e-76
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 627 E_value: 3e-66
PFAM Definition: HATPase_c, Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase. This family represents the structurally related ATPase domains of histidine kinase, DNA gyrase B and HSP90..
Pfam Number: pfam02518 Score: 128 E_value: 2e-08
Swissprot: P40292|HSP90_ASPFU

Sequence:
>Contig2556
TTGGTAGCAAACAACCATTGCCATCTTCTCGGGTCTATGAATCTCTAAAG
GTGCAGGGAAATAGAGAGGTGAATGAGGAGATAGCAAACAACCATTGCCA
TGGCTGAAACCTTCGAATTCCAAGCTGAGATCTCTCAGTTGCTCTCCCTC
ATCATTAATACTGTATACTCGAATAAGGAGATTTTCCTTCGAGAATTGAT
CTCCAATGCCTCAGACGCTTTGGACAAGATTCGCTACATTTCTCTTTCCG
ACGCTAGCGTCTTGGAAGAGGAGAAGGATCTGAAAATTCACATTATCCCT
AACAAGGAGGCCAAGACTCTTTCAATTTTTGATACTGGTATCGGCTTTAC
TAAATCTGATTTGGTAAACAATCTTGGTACCATTGCCCGATCTGGTACAA
AGCAGTTCATGGAGGCCCTGTCCGCAGGTGCTGATATCTCGATGATTGGT
CAATTTGGTGTTGGTTTCTACTCGGCATATCTTGTTGCCGATAAGGTTGA
GGTTGTTACCAAGTCGAACGAAGATGAACAATACATCTGGGAGTCGGCTG
CTGGTGGTTCTTTTACTATCAAATTGGATGAGACCGGAGAAAGAATCAAG
CGTGGTACCAAGATTGTCCTTCATATCAAGGATGGTCTGCAAGAGT

Sequences in the Contig:

SY0AAA39YB02FM1 SY0AAB33YB14FM1