Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig2341
Length(NT) : 1497
Best Gene Model Blast : Link to GSTUMT00005090001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_05796
Accession: ref|XP_001592874.1| Score: 427 E_value: 6e-40
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01327 Score: 367 E_value: 3e-33
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4628 Score: 162 E_value: 7e-12
PFAM Definition: No Hit Found
Swissprot: Q91XF4|RN167_MOUSE

Sequence:
>Contig2341
TTGGGAGAAATTTCTAGATTGGGCCGAAAAGCATGAAGATCTAGCAAATG
ACTATCCAGAGGAGGAGGATTTATATTTTATCTCGATGATAAAGCTGCGA
AGATTCCCGAGGTGAAGGATCCTTATTGGCATGGTGTTCCATTCGATAAT
TTCGAGTTCCCAATCTATGCCATCCCTGGGAGAGATGGCATACCCCTGTT
GGACAAGATTGCCGAATATTCCGGGAATATGTCGGAGGTTTGGGAGGCCC
AAAATCTAACGTCCTACTATGATCCAAAGGATTTTGCCAGGGTTTATATG
GAGGTAGATACAGGCCATCGGAACCCGTTACCAGGACTCTGGTTGTTCCT
ACTGATAGTTCTCGGCGTGCTTCTTGGCATTGTGGGATTAACGTCTCTTA
GCATGCATATGCTTCAATACCGACATCTGCAGGGACTTCGCCGTCGAGTT
GCAAACGGACAGGTCGACCTCGAAGCATTAGGCATAAAGCGACTCTCTGT
CCCACGACGAATTCTGGAAAAGTTCCCAATTCGAATATATGTTCCTGAAC
CAACATCTCCTACTATTCCCGCATCCACCTATTCCTTGCCGGTATCCCCT
CGACCTACCCGATCTATTTCTAATCCTCCAAGAACTCCCCCACCCGTTAG
ATATTTTGCCCCTCCCGATCCACCTTTACCACCTTCACCTACGCCTGCGA
GACGACGTCAAAGCCGGGACCGACGTAATGACCCTGTGCATGATACAACT
CTCCAACGTGGTTATTCTCAATCACAATGCTCCATCTGCTTAGACGACTT
TATTCCGTATTCCACAGCTGTCCGTGAATTACCTTGTCTTCATGTCTTCC
ATCCTGATTGCATCGACCCATTTCTCGAAACCCAATCTTCTCTATGCCCA
TTGTGCAAGGTTTCAGCGTTACCCAGAGGCTATGTCCCGCCTCAGCTGAC
CAATGCCACGGTGCGACGAGAGCGGAACCTTCGGCGGATGCGGGCTCGAG
TGGATGCCGGTGGCGGCGTTTTGTCTTGGTGGGCCAGACTTAGGTTCCGC
ATAAGTTCAAGTAGGCATGAGGAGGAAGAGCGTGATCTCCGAAATACTGC
GAGAATGGCGGTAGCGCGAAACAATCCGGTGACGGAAATAAGCGAATACA
GTAGAGGATCAAGCCGATTGCCCGCGGATAGCCCGGGGGAGTCCCACGTG
GATGACGAGGAAGTGGGGGAGAATAATCGTTCCAGGTGGAGAAAAGCTAT
GAAGACATTGTTTCCTGGCTTTGGGTAGCATACTGCTAGATTAGTATCGT
ATTTGAGTATTGGTCTCTCTTTCGGTTTAGGGGGTGTTATATTCTATCAT
TTGCATTCCTGTTACTATATCATTGGGTTACGAATGGGTCGCTCTTTGGT
GCATGGGTTGTTTTTGAATGTCCCTGGGGTGGATTGAGTGCATGGGAATT
CTGGCGTTCTTGTTTCCATTTTCCATTCTCTCCTCCCCACACGTCTG

Sequences in the Contig:

SY0AAA24YD22FM1 SY0AAA24YD22FM2 SY0AAA3YM21FM1
SY0AAA53YP09FM1 SY0AAB15YF07FM1 SY0AAB24YO11FM1