Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig2336
Length(NT) : 903
Best Gene Model Blast : Link to GSTUMT00001368001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig2336
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACCAAA
GTTGTCCCCAGAGGGAGGAGGAGGAGCGGAAGAAGGCTGAGGAGGAGCGA
TTGAAAGCAGAGCGGGAAAAAAAGGCGGCGGAGGTTCTGGAGTACATCGA
CTCGTGTCTGGATAAGGCGTCGAAAGGGTGTGAGAATGCTGCCTTCTTGT
GGTTGAAAGGGGATATCTGCGCAGGTCACATTTCTTTCATCAATTCGAGA
ATGCAGGAGGCAGTGGATCGGATCAACCTAGAGATAGATAAGATGAAGCC
AGTCGCGCCTCCTGCTCCCGCTCCCGCCGTGGAGGATGAGGGTATTGGTG
CAGAGATGGATATTGACGCTGACGATACACCGACAACCATTGCTCTACCA
CCTCGGAAGATGGACACTGCGATGCATGACTCCAGAGTAGTCGGAGTCAG
CTAACACCACCCTCTTGGTTTCATACCAAGTATGTCTTTTTTTTCACCTC
TTTTCTGCATCCGCCCCCAGCCAACTCCTAAGCATTAAAACCACCGTTCA
TACTCGCTCGCTGGACCGTACATATAGCCTTCCTCTTTCCTTCTGGTCAA
GCCAATCATGCATTTCTAAAAGCACCTTTGATATACTCTTATTTATTACC
CCACCCTATTTCATACTCCGAATTGGATTTTGGTTGCTCTCATTCTTCCA
TTCTTTTGCACAACGTTAAACCTCTCAAGTTTTTCTGTTCACGCAAACTT
TTTTCATCCCTAGGATTTCAATTTCTCGTTTGTTCGTTTTCTTTTGTCTT
TACATCGGGACTTGACGAATTCATATTATGACGGGGTTTTTTTTTTACAG
TTTTCCTCTGGTTCTTTCTGAATGGGTTGCTGTTCTCACTTGGTATATTC
TGG

Sequences in the Contig:

SY0AAA28YG10FM1 SY0AAB24YM03FM1 SY0AAC21YB05FM1