Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig2252
Length(NT) : 1787
Best Gene Model Blast : Link to GSTUMT00008458001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: myosin I MyoA
Accession: ref|XP_001276671.1| Score: 1495 E_value: 1e-163
KEGG Definition: myosin I MyoA/Myo5; K10356 myosin I
Accession: afm:AFUA_8G05660 Score: 1415 E_value: 1e-154
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0162 Score: 1119 E_value: 1e-122
PFAM Definition: Myosin_TH1, Myosin tail..
Pfam Number: pfam06017 Score: 405 E_value: 6e-40
Swissprot: Q04439|MYO5_YEAST
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0000146 = Molecular function: microfilament motor activity
GO:0005515 = Molecular function: protein binding
GO:0007121 = Biological process: bipolar cellular bud site selection
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0006887 = Biological process: exocytosis
GO:0006898 = Biological process: receptor-mediated endocytosis
GO:0009651 = Biological process: response to salt stress

Sequence:
>Contig2252
TTGGGCAGTATTACATCAAATTAAGTATCTAGGATTGCAGGAGAACGTTC
GCATTCGAAGAGCAGGATTTGCGTATCGCCAGACCTTTGAAAAGTTTATT
GAGCGATTTTATCTTTTATCGCCTAAAACTTCCTATGCTGGTGACTATAC
TTGGACTGGAGACGCACGCACGGGTACCCTTCAGATTCTGAAAGATACAA
GTATCCCGAAAGAGGAATATCAGATGGGTGTCTCCAAGGCATTCATTAAG
ACACCTGAGACATTGTTTGCGCTGGAAACGATGAGGGATAGGTATTGGCA
TAACATGGCAATTAGAATCCAGCGTGCTTGGAGGAATTACTTGAGATACC
GAGCGGAGTGCGCAACCAGGATTCAGAGGGCTTGGAGAAAGAAGAGAGGT
GGGGAGGAATTTTTGAAGATCAGAGATCAGGGGCACAAGCTACTTGGGGG
AAGGAAAGAAAGGAGGAGAATGAGTTTATTGGGTAGCCGTAGGTTTATGG
GAGATTATCTGGGCGTAGCGAACGTAGGGAGTCGACTAGAGCCCATTCGT
GCGCCTGCGGGAATTGGGCTAGGGGAAAAAGTTTTGTTTAGCTGCAGGTC
TAAGGTCTTGGTATCCAAATTAGGGCGAAGCAGCAAGCCGAGTCCTAGAA
TACTAGTTATGACCAACAAAGCAATATATATCGTGATTCAAGCTATGGCC
AACGGTCAAGTCGCGATATCTTCCGAGAGGACCATGCCGCTCGGGTCCAT
CAAGTTTGTTAGCATGTCTAGCCTCCGAGATGATTGGTTTTCTCTTGGAG
TTGGTTCTCCTCAGCAACCGGATACGCTCGTTTCCTGCGTCTTCAAAACA
GAGCTCGTAACACATCTACGGGCGGCTATGCCTGGTGGGCTCGATTTGAG
GATTGGGCCAGTCATTGAATACGCCAAAAAACCTGGAAAGATGGCGGCTG
TTAAGGTCGTTAAAGACCTTGCTATCCCAAGAGACGATCTTTACAAGAGC
TCCACTATTCATGTGGGGCCCGGGGAGCCACCAAACAGTATTTCAAGACC
GACCCCTAAAGGGAAACCTGTTGCTGCCAGGCCAGTAACTTCCGGCAAAC
TTCTGAAGCCCGGCGGGCCGAGGGGTGGGCCAGCAAGAAATAAAAATCCA
GTAATGGCTGAAAGGCCGGTCCCGCAACCTGTCCCGCAGCCTGTTCCACG
CCCGACACCTCAGCCAAGCATGACTCCAGCTCCAAACGCAAACGCCAGTG
CATTACTCCCTGTCCCTCCAAAATCAGTTGTGCCGGAGGGTCGGGCAGTC
CCTCAAAATCTTATTGCGGCTTTGAATACTCATTCCCGCAATTCTTCCAC
TGGTTCAGCGAGCCGTATTCCCCCGCCGGCACCGCCTGCGCCTCCAGCTG
CGCCTCCCCGCGTTGCTGACCCTACCTGTCGGGCTCTGTACGACTTCGCG
GGCCAAACTGAAAACGAGCTCTCACTTTCGAAAGATGAAGTAGTTATAAT
TATTCGTAAGGAGGCGAATGGGTGGTGGCTTACTAAGAAAATGAATTCTA
CTGAACAAGGTTGGGCACCGTCGGCATACCTTGAAGAAGAGGCTGCTCCT
CCCCCTACCCCACCGCCACCACCTGTTGCCCCTGCTCGACCGGCAAATGG
GGCGGCTAGACCAGCAGGTAGGAAACCGGCACCACCAGCCCCTCCGGCAA
AGAGGCCAACTGTTGGGAGAAAGCCTGCAACGGTGGAGAACAGAAGCAGT
GTCGCGGGTAGTACTAGTAGTAGTAGTAGTGGGGCCG

Sequences in the Contig:

SY0AAA17YO15FM1 SY0AAA38YI08FM1 SY0AAB21YJ03FM1
SY0AAB39YI01FM1 SY0AAB60YD23FM1 SY0AAB6YJ06FM1
SY0AAC36YI08FM1 SY0AAD52YH07FM1