Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig2119
Length(NT) : 2538
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 0.0
Numbers of ESTs : 723

Blast Results:

Nr Definition: heat shock protein sspB-Aspergillus niger emb|CAK40452.1| heat shock protein sspB-Aspergillus niger
Accession: ref|XP_001393974.1| Score: 2235 E_value: 0.0
KEGG Definition: sspB; heat shock protein sspB-Aspergillus niger
Accession: ang:An09g06590 Score: 2235 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 2261 E_value: 0.0
PFAM Definition: HSP90, Hsp90 protein..
Pfam Number: pfam00183 Score: 2266 E_value: 0.0
Swissprot: O43109|HSP90_PODAN

Sequence:
>Contig2119
TTGGGGGGACAACTTTGTAACAGAATAATCTTGGGTTTAGAGAAACACTC
TCGACTTTTCTCAGAGCCCAATCAATTTCTCCTGCATCTCCTCATTCACC
TCTCTATTTCCCTGCACCTTTAGAGATTCATAGACCCGAGAAGATAGCAA
ACAACCATTGCCATGGCTGAAACCTTCGAATTCCAAGCTGAGATCTCTCA
GTTGCTCTCCCTCATCATTAATACTGTATACTCGAATAAGGAGATTTTCC
TTCGAGAATTGATCTCCAATGCCTCAGACGCTTTGGACAAGATTCGCTAC
ATTTCTCTTTCCGACGCTAGCGTCTTGGAAGAGGAGAAGGATCTGAAAAT
TCACATTATCCCTAACAAGGAGGCCAAGACTCTTTCAATTTTTGATACTG
GTATCGGCTTTACTAAATCTGATTTGGTAAACAATCTTGGTACCATTGCC
CGATCTGGTACAAAGCAGTTCATGGAGGCCCTGTCCGCAGGTGCTGATAT
CTCGATGATTGGTCAATTTGGTGTTGGTTTCTACTCGGCATATCTTGTTG
CCGATAAGGTTGAGGTTGTTACCAAGTCGAACGAAGATGAACAATACATC
TGGGAGTCGGCTGCTGGTGGTTCTTTTACTATCAAATTGGATGAGACCGG
AGAAAGAATCAAGCGTGGTACCAAGATTGTCCTTCATATCAAGGATGGTC
TGCAAGAGTATCTCGAGGAGTCTAAGATTAAGGAGATCGTGAAGAAGCAC
TCCGAGTTCATTTCATACCCTATTTTCCTCCACGTCACCAAAGAGGTTGA
GAGAGAAGTTCCTGACGAGGATGAGGAGGAAGAGAAGACAGAAGAGGGTG
ATGATAAGAAGCCCAAGATTGAAGAGGTCGATGAAGAAGAGGAAAAGAAG
GAGAAGAAGACCAAGAAGGTGAAGGAGACCAAGGAAGAGGAAGAGGAGCT
GAACAAGACAAAGCCCATCTGGACTCGTAACCCCTCCGACATCACTACTG
AGGAGTATGCCAGCTTCTACAAGTCTCTATCCAACGACTGGGAAGATCAC
CTTGCTGTCAAGCATTTCTCGGTTGAGGGCCAACTTGAGTTCCGCGCCAT
CCTTTTTGTCCCCAAGCGTGCTCCCTTCGACTTGTTCGAGACCAAGCGCT
CCAAAAACAACATTAAGCTCTACGTCCGCCGTGTATTCATTACTGACGAC
TGTACTGATTTGATTCCGGAATGGCTTGGTTTCATCAAGGGGGTTGTCGA
TTCTGAGGATCTCCCACTTAACTTGTCTCGTGAGACTCTCCAACAGAACA
AGATCTTGAAAGTTATCAAGAAAAACATTGTCAAGAAAACTCTTGAGATG
TTCAACGAGATCTCCGAGGACCGTGAGCAGTTCGACAAGTTTTACAGTGC
CTTTAGCAAGAACATTAAGCTTGGCATTCATGAGGATGCCCAAAATCGTC
CTGCCCTTGCCAAGCTTCTCCGCTTCAACTCTACTAAGAGCGGGGACGAC
GCCACATCTTTGACTGACTACGTTACCCGCATGCCCGAGCACCAAAAGCA
GATGTACTACATCACTGGTGAGTCTTTGAAGGCAGTTTCCAAGTCTCCCT
TCTTGGACGCTCTCAAAGCCAAGGACTTCGAGGTTCTTTTCTTGGTCGAC
CCTATTGACGAGTACGCTATGACTCAACTCAAGGAATTTGATGGCAAGAA
GTTGGTTGATATTACCAAAGATTTCGAGCTTGAGGAGACTGAAGATGAGA
AGAAGCAGCGTGAGGAGGAGGAGAAAGCTTTCGAGGGATTGGCTAAGACT
CTCAAGGAGGTTCTCGGTGAGAAGGTCGAGAAGGTCGTCGTTTCCCACAA
GTTGGTTGATGCTCCCGCTGCTATTCGTACTGGTCAGTTCGGTTGGTCTG
CCAACATGGAGCGTATCATGAAGTCACAAGCTCTGCGTGATACTTCGATG
AGCTCGTATATGGCATCCAAGAAGACCTTTGAAATCTCTCCTAAATCACC
AATCATCAAGGCCTTGAAGGAGAAGGCTGAGGAGGAAGGTGGTTCCAAGG
CCGTCGCTAGCATTGCCACTCTCTTATACGAGACTGCGATGTTGACTTCT
GGCTTCACCCTCGAGGAGCCTAATGCCTTTGCTCAGCGTGTCAACCGCCT
CATCGCTCTTGGTCTCCAAATTGAGGAGAAGGACGATGAAGAAGAGCCTG
AGGCGGAGGCAGCTCCGGCCGCCGAATCTTCAGCAGCCCCTGAGAGCTCG
ATGGAGGAGGTTGACTAAACTTTATGATTTACGTTTCCTTCTTCAAATAA
AAAAGTTTCTTTGTTTCGTTCTCCTTCGTGTACTTTTTTCTTCTTCCTGT
CCTTCGGTTAGTATGGTGATGGACGAACGACAGATATAGGGTAATGGATT
TCATTTTCTCTCCTCCCCCCCTTGTATTTCTTTACCGAAGAAATCATTCG
TTAAGTGCATCGAGGGCTGGGGTTATGAATACCATTGATGTTTAAAGGTT
GAATTAATTGAATGCAATGGCGTTTATCAAAACTTGTT

Sequences in the Contig:

SY0AAA10YB14FM1 SY0AAA10YI12FM1 SY0AAA10YK06FM1
SY0AAA10YM16FM1 SY0AAA10YN02FM1 SY0AAA11YE09FM1
SY0AAA11YL11FM1 SY0AAA11YN10FM1 SY0AAA11YN11FM1
SY0AAA11YN23FM1 SY0AAA11YO20FM1 SY0AAA11YP14FM1
SY0AAA12YD17FM1 SY0AAA12YF06FM1 SY0AAA12YG10FM1
SY0AAA12YG11FM1 SY0AAA12YI12FM1 SY0AAA12YJ02FM1
SY0AAA12YJ08FM1 SY0AAA12YJ10FM1 SY0AAA12YJ22FM1
SY0AAA12YL23FM1 SY0AAA12YO02FM1 SY0AAA13YD17FM1
SY0AAA13YJ09FM1 SY0AAA13YK02FM1 SY0AAA13YK11FM1
SY0AAA13YO19FM1 SY0AAA13YP09FM1 SY0AAA14YA24FM1
SY0AAA14YJ07FM1 SY0AAA14YJ09FM1 SY0AAA15YA08FM1
SY0AAA16YA09FM1 SY0AAA16YB14FM1 SY0AAA16YD09FM1
SY0AAA16YD19FM1 SY0AAA16YG24FM1 SY0AAA16YO19FM1
SY0AAA17YB13FM1 SY0AAA17YD22FM1 SY0AAA17YE23FM1
SY0AAA17YL17FM1 SY0AAA18YK08FM1 SY0AAA18YL01FM1
SY0AAA18YN22FM1 SY0AAA18YN22RM1 SY0AAA18YO20RM1
SY0AAA18YP14FM1 SY0AAA18YP14RM1 SY0AAA19YB04FM1
SY0AAA19YD06FM1 SY0AAA19YG11FM1 SY0AAA19YI10FM1
SY0AAA19YP09FM1 SY0AAA1YA04FM1 SY0AAA1YC20FM1
SY0AAA1YG01FM1 SY0AAA1YO14FM1 SY0AAA20YE09FM1
SY0AAA20YG14FM1 SY0AAA21YC04RM1 SY0AAA21YD02FM1
SY0AAA21YJ13FM1 SY0AAA21YL03RM1 SY0AAA21YL06RM1
SY0AAA21YL12FM1 SY0AAA21YL12RM1 SY0AAA21YP07FM1
SY0AAA22YH04FM1 SY0AAA22YK02FM1 SY0AAA22YN18FM1
SY0AAA23YB17FM1 SY0AAA23YB21FM1 SY0AAA23YC14FM1
SY0AAA23YI01FM1 SY0AAA23YI01RM1 SY0AAA23YI05FM1
SY0AAA23YI23FM1 SY0AAA23YJ18FM1 SY0AAA23YP01FM1
SY0AAA24YB09FM2 SY0AAA24YB17FM1 SY0AAA24YB17FM2
SY0AAA24YD23FM1 SY0AAA24YD23FM2 SY0AAA24YJ04FM1
SY0AAA24YJ04FM2 SY0AAA24YJ04RM1 SY0AAA24YM05FM2
SY0AAA24YM05RM1 SY0AAA24YN12FM2 SY0AAA24YP08FM1
SY0AAA24YP08FM2 SY0AAA25YB05FM1 SY0AAA25YD17FM1
SY0AAA25YD17RM1 SY0AAA25YG11FM1 SY0AAA25YL09RM1
SY0AAA25YL20FM1 SY0AAA25YN22RM1 SY0AAA25YO08FM1
SY0AAA26YA14FM1 SY0AAA26YA14RM1 SY0AAA26YB18FM1
SY0AAA26YB18RM1 SY0AAA26YD09FM1 SY0AAA26YE03FM1
SY0AAA26YE23FM1 SY0AAA26YF10FM1 SY0AAA26YF18FM1
SY0AAA26YH11FM1 SY0AAA26YJ04FM1 SY0AAA26YJ17FM1
SY0AAA26YK22FM1 SY0AAA26YN03FM1 SY0AAA26YN03RM1
SY0AAA26YP01FM1 SY0AAA26YP10FM1 SY0AAA27YA14FM1
SY0AAA27YA17FM1 SY0AAA27YC17FM1 SY0AAA27YE22FM1
SY0AAA27YJ24FM1 SY0AAA28YF02FM1 SY0AAA28YJ02FM1
SY0AAA28YL03FM1 SY0AAA29YF02FM1 SY0AAA29YH02FM1
SY0AAA29YL16FM1 SY0AAA2YH20FM1 SY0AAA2YK22FM1
SY0AAA2YL18FM1 SY0AAA2YP03FM1 SY0AAA2YP10FM1
SY0AAA2YP13FM1 SY0AAA30YG17FM1 SY0AAA30YH14FM1
SY0AAA30YJ02FM1 SY0AAA30YJ21FM1 SY0AAA30YJ21RM1
SY0AAA30YM15FM1 SY0AAA31YB11FM1 SY0AAA31YD04FM1
SY0AAA31YD04RM1 SY0AAA31YE13FM1 SY0AAA31YM18FM1
SY0AAA31YO04FM1 SY0AAA31YP07FM1 SY0AAA32YD03FM1
SY0AAA32YD03RM1 SY0AAA32YF09FM1 SY0AAA32YG19FM1
SY0AAA32YI11FM1 SY0AAA32YI11RM1 SY0AAA32YI19FM1
SY0AAA32YI19RM1 SY0AAA32YJ24FM1 SY0AAA32YJ24RM1
SY0AAA32YO02FM1 SY0AAA33YD24FM1 SY0AAA33YI16FM1
SY0AAA33YI23FM1 SY0AAA33YK06FM1 SY0AAA33YL04FM1
SY0AAA33YM04FM1 SY0AAA33YM16FM1 SY0AAA33YN18FM1
SY0AAA33YP09FM1 SY0AAA34YC21FM1 SY0AAA34YF06FM1
SY0AAA34YI09FM1 SY0AAA34YJ19FM1 SY0AAA34YJ23FM1
SY0AAA34YK22FM1 SY0AAA34YM08FM1 SY0AAA34YN04FM1
SY0AAA35YC09FM1 SY0AAA35YC10FM1 SY0AAA35YE08FM1
SY0AAA35YE20FM1 SY0AAA35YG06FM1 SY0AAA35YI23FM1
SY0AAA35YK23FM1 SY0AAA35YM22FM1 SY0AAA35YM23FM1
SY0AAA35YN11FM1 SY0AAA36YB06FM1 SY0AAA36YC21FM1
SY0AAA36YF13FM1 SY0AAA36YH07FM1 SY0AAA36YI09FM1
SY0AAA36YI18FM1 SY0AAA36YJ19FM1 SY0AAA36YK17FM1
SY0AAA36YL21FM1 SY0AAA36YN18FM1 SY0AAA36YO09FM1
SY0AAA37YA07FM1 SY0AAA37YC23FM1 SY0AAA37YE14FM1
SY0AAA37YG19FM1 SY0AAA37YM13FM1 SY0AAA37YM21FM1
SY0AAA38YB09FM1 SY0AAA38YF15FM1 SY0AAA38YF20FM1
SY0AAA38YI18FM1 SY0AAA38YL19FM1 SY0AAA38YM21FM1
SY0AAA38YP03FM1 SY0AAA38YP13FM1 SY0AAA39YC11FM1
SY0AAA39YD14FM1 SY0AAA39YD21FM1 SY0AAA39YG08FM1
SY0AAA39YI17FM1 SY0AAA39YJ21FM1 SY0AAA39YK02FM1
SY0AAA3YB23FM1 SY0AAA3YH12FM1 SY0AAA3YJ12FM1
SY0AAA3YM09FM1 SY0AAA40YA07FM1 SY0AAA40YC12FM1
SY0AAA40YD07FM1 SY0AAA40YK13FM1 SY0AAA40YL15FM1
SY0AAA40YM24FM1 SY0AAA41YA13FM1 SY0AAA41YA14FM1
SY0AAA41YB08FM1 SY0AAA41YB21FM1 SY0AAA41YD15FM1
SY0AAA41YH03FM1 SY0AAA41YJ10FM1 SY0AAA41YL11FM1
SY0AAA41YM23FM1 SY0AAA41YO03FM1 SY0AAA42YF09FM1
SY0AAA42YG14FM1 SY0AAA42YG15FM1 SY0AAA42YG22FM1
SY0AAA42YH12FM1 SY0AAA42YI02FM1 SY0AAA42YJ09FM1
SY0AAA42YL11FM1 SY0AAA42YN03FM1 SY0AAA42YP04FM1
SY0AAA42YP23FM1 SY0AAA43YD12FM1 SY0AAA43YI14FM1
SY0AAA43YK12FM1 SY0AAA43YO06FM1 SY0AAA44YA02FM1
SY0AAA44YA07FM1 SY0AAA44YC21FM1 SY0AAA44YD01FM1
SY0AAA44YD16FM1 SY0AAA44YF21FM1 SY0AAA44YG22FM1
SY0AAA44YI18FM1 SY0AAA44YK10FM1 SY0AAA44YN21FM1
SY0AAA45YD10FM1 SY0AAA45YD17FM1 SY0AAA45YG11FM1
SY0AAA45YG19FM1 SY0AAA45YH03FM1 SY0AAA45YI08FM1
SY0AAA45YI12FM1 SY0AAA45YM16FM1 SY0AAA45YO07FM1
SY0AAA46YC07FM1 SY0AAA46YL11FM1 SY0AAA46YM20FM1
SY0AAA47YB18FM1 SY0AAA47YH02FM1 SY0AAA47YH20FM1
SY0AAA47YI06FM1 SY0AAA47YN14FM1 SY0AAA48YG19FM1
SY0AAA48YJ03FM1 SY0AAA48YK08FM1 SY0AAA48YL14FM1
SY0AAA48YL21FM1 SY0AAA48YN10FM1 SY0AAA48YP16FM1
SY0AAA49YA09FM1 SY0AAA49YA18FM1 SY0AAA49YG21FM1
SY0AAA49YJ11FM1 SY0AAA49YJ20FM1 SY0AAA49YM19FM1
SY0AAA4YB15FM1 SY0AAA4YE23FM1 SY0AAA4YG01FM1
SY0AAA4YH03FM1 SY0AAA4YH04FM1 SY0AAA4YK21FM1
SY0AAA4YL17FM1 SY0AAA4YN20FM1 SY0AAA50YA12FM1
SY0AAA50YD05FM1 SY0AAA50YH19FM1 SY0AAA50YN24FM1
SY0AAA50YO05FM1 SY0AAA52YC19FM1 SY0AAA52YD07FM1
SY0AAA52YD18FM1 SY0AAA52YM04FM1 SY0AAA52YO11FM1
SY0AAA53YE12FM1 SY0AAA53YI02FM1 SY0AAA53YJ20FM1
SY0AAA53YJ22FM1 SY0AAA53YL21FM1 SY0AAA53YO18FM1
SY0AAA53YO23FM1 SY0AAA53YP12FM1 SY0AAA54YA03FM1
SY0AAA54YE19FM1 SY0AAA54YG08FM1 SY0AAA54YL08FM1
SY0AAA54YM07FM1 SY0AAA54YP07FM1 SY0AAA55YE08FM1
SY0AAA55YH17FM1 SY0AAA55YL11FM1 SY0AAA55YM06FM1
SY0AAA55YN13FM1 SY0AAA56YD17FM1 SY0AAA56YE03FM1
SY0AAA56YF09FM1 SY0AAA57YB15FM1 SY0AAA57YD06FM1
SY0AAA57YD07FM1 SY0AAA57YG14FM1 SY0AAA57YJ14FM1
SY0AAA57YN16FM1 SY0AAA57YO22FM1 SY0AAA58YA18FM1
SY0AAA58YB18FM1 SY0AAA58YE07FM1 SY0AAA58YG07FM1
SY0AAA58YG16FM1 SY0AAA58YJ11FM1 SY0AAA58YK07FM1
SY0AAA58YM17FM1 SY0AAA58YN24FM1 SY0AAA58YP06FM1
SY0AAA59YF08FM1 SY0AAA59YG24FM1 SY0AAA5YA13FM1
SY0AAA5YN09FM1 SY0AAA5YO06FM1 SY0AAA60YH16FM1
SY0AAA60YK18FM1 SY0AAA60YK23FM1 SY0AAA60YL09FM1
SY0AAA60YM02FM1 SY0AAA60YM14FM1 SY0AAA60YO08FM1
SY0AAA60YP01FM1 SY0AAA60YP16FM1 SY0AAA61YB24FM1
SY0AAA61YD18FM1 SY0AAA61YG05FM1 SY0AAA61YG13FM1
SY0AAA61YL13FM1 SY0AAA61YL17FM1 SY0AAA61YM23FM1
SY0AAA61YP18FM1 SY0AAA62YD09FM1 SY0AAA62YD20FM1
SY0AAA62YG22FM1 SY0AAA62YL18FM1 SY0AAA63YA05FM1
SY0AAA63YA10FM1 SY0AAA63YB13FM1 SY0AAA63YE04FM1
SY0AAA63YG03FM1 SY0AAA63YH23FM1 SY0AAA63YI17FM1
SY0AAA63YK07FM1 SY0AAA63YO24FM1 SY0AAA6YB04FM1
SY0AAA6YB15FM1 SY0AAA6YD10FM1 SY0AAA6YG04FM1
SY0AAA6YH12FM1 SY0AAA6YH18FM1 SY0AAA6YI20FM1
SY0AAA6YJ05FM1 SY0AAA6YM15FM1 SY0AAA7YD21FM1
SY0AAA7YJ01FM1 SY0AAA7YL18FM1 SY0AAA7YO10FM1
SY0AAA8YD07FM1 SY0AAA8YE09FM1 SY0AAA9YA12FM1
SY0AAA9YA15FM1 SY0AAA9YB01FM1 SY0AAA9YE08FM1
SY0AAA9YE19FM1 SY0AAA9YG18FM1 SY0AAA9YH08FM1
SY0AAA9YJ08FM1 SY0AAA9YK05FM1 SY0AAA9YL19FM1
SY0AAA9YP18FM1 SY0AAB10YE01FM1 SY0AAB10YE09FM1
SY0AAB10YE20FM1 SY0AAB10YF16FM1 SY0AAB10YN16FM1
SY0AAB11YC10FM1 SY0AAB11YE15FM1 SY0AAB11YO11FM1
SY0AAB12YJ10FM1 SY0AAB12YM15FM1 SY0AAB13YA09FM1
SY0AAB13YA24FM1 SY0AAB14YD03FM1 SY0AAB14YI24FM1
SY0AAB14YN16FM1 SY0AAB15YB10FM1 SY0AAB15YF23FM1
SY0AAB15YL17FM1 SY0AAB15YP04FM1 SY0AAB16YF02FM1
SY0AAB16YF06FM1 SY0AAB16YI19FM1 SY0AAB16YM12FM1
SY0AAB16YO18FM1 SY0AAB17YA21FM1 SY0AAB17YC06FM1
SY0AAB17YF09FM1 SY0AAB17YH24FM1 SY0AAB17YK23FM1
SY0AAB17YN17FM1 SY0AAB17YO04FM1 SY0AAB18YB05FM1
SY0AAB18YE24FM1 SY0AAB18YH14FM1 SY0AAB18YJ13FM1
SY0AAB18YN04FM1 SY0AAB18YN23FM1 SY0AAB19YC05FM1
SY0AAB19YF05FM1 SY0AAB1YF08FM1 SY0AAB1YH19FM1
SY0AAB1YP13FM1 SY0AAB20YG02FM1 SY0AAB20YK10FM1
SY0AAB20YP15FM1 SY0AAB20YP16FM1 SY0AAB20YP21FM1
SY0AAB21YA06FM1 SY0AAB21YJ06FM1 SY0AAB22YN05FM1
SY0AAB22YO16FM1 SY0AAB23YA14FM1 SY0AAB23YA15FM1
SY0AAB23YF07FM1 SY0AAB23YF09FM1 SY0AAB23YF14FM1
SY0AAB23YJ24FM1 SY0AAB23YK11FM1 SY0AAB23YM12FM1
SY0AAB23YM19FM1 SY0AAB23YN02FM1 SY0AAB24YA16FM1
SY0AAB24YB20FM1 SY0AAB24YK23FM1 SY0AAB25YB17FM1
SY0AAB25YG09FM1 SY0AAB25YL05FM1 SY0AAB26YF15FM1
SY0AAB26YG14FM1 SY0AAB26YH10FM1 SY0AAB26YP18FM1
SY0AAB27YB10FM1 SY0AAB27YG15FM1 SY0AAB27YM13FM1
SY0AAB28YC16FM1 SY0AAB28YF06FM1 SY0AAB28YP07FM1
SY0AAB28YP19FM1 SY0AAB29YB08FM1 SY0AAB29YC15FM1
SY0AAB29YE10FM1 SY0AAB29YM22FM1 SY0AAB2YE02FM1
SY0AAB2YJ12FM1 SY0AAB30YC01FM1 SY0AAB30YK09FM1
SY0AAB30YM23FM1 SY0AAB31YA09FM1 SY0AAB31YB01FM1
SY0AAB31YB12FM1 SY0AAB31YD21FM1 SY0AAB31YE08FM1
SY0AAB31YF09FM1 SY0AAB31YF11FM1 SY0AAB31YL19FM1
SY0AAB32YC07FM1 SY0AAB32YD06FM1 SY0AAB32YF05FM1
SY0AAB32YF20FM1 SY0AAB32YG20FM1 SY0AAB32YP13FM1
SY0AAB32YP24FM1 SY0AAB33YA05FM1 SY0AAB33YG16FM1
SY0AAB33YG21FM1 SY0AAB33YH14FM1 SY0AAB33YI23FM1
SY0AAB33YM17FM1 SY0AAB33YN15FM1 SY0AAB34YA12FM1
SY0AAB34YA15FM1 SY0AAB34YJ11FM1 SY0AAB35YA04FM1
SY0AAB35YC07FM1 SY0AAB35YC21FM1 SY0AAB35YD21FM1
SY0AAB35YH12FM1 SY0AAB35YO16FM1 SY0AAB36YD01FM1
SY0AAB36YF11FM1 SY0AAB36YI10FM1 SY0AAB36YL16FM1
SY0AAB36YM16FM1 SY0AAB37YF02FM1 SY0AAB37YK18FM1
SY0AAB37YN20FM1 SY0AAB38YE12FM1 SY0AAB38YH04FM1
SY0AAB38YK02FM1 SY0AAB38YO05FM1 SY0AAB39YH23FM1
SY0AAB39YJ06FM1 SY0AAB39YM08FM1 SY0AAB3YB10FM1
SY0AAB3YD02FM1 SY0AAB3YK21FM1 SY0AAB3YM19FM1
SY0AAB3YO06FM1 SY0AAB40YB19FM1 SY0AAB40YG14FM1
SY0AAB40YL17FM1 SY0AAB40YL23FM1 SY0AAB40YP09FM1
SY0AAB40YP23FM1 SY0AAB41YE09FM1 SY0AAB41YG13FM1
SY0AAB41YG20FM1 SY0AAB41YH06FM1 SY0AAB41YH18FM1
SY0AAB41YN20FM1 SY0AAB42YC17FM1 SY0AAB42YE12FM1
SY0AAB42YF18FM1 SY0AAB42YG19FM1 SY0AAB42YM20FM1
SY0AAB43YA15FM1 SY0AAB43YA21FM1 SY0AAB43YG22FM1
SY0AAB43YJ15FM1 SY0AAB43YM05FM1 SY0AAB43YM13FM1
SY0AAB43YM20FM1 SY0AAB43YM23FM1 SY0AAB43YO16FM1
SY0AAB43YP23FM1 SY0AAB44YO02FM1 SY0AAB45YB19FM1
SY0AAB45YC01FM1 SY0AAB45YC17FM1 SY0AAB45YD08FM1
SY0AAB45YE18FM1 SY0AAB45YE21FM1 SY0AAB45YF16FM1
SY0AAB45YG11FM1 SY0AAB45YH23FM1 SY0AAB45YJ06FM1
SY0AAB45YJ24FM1 SY0AAB46YB16FM1 SY0AAB46YH07FM1
SY0AAB47YC23FM1 SY0AAB47YF18FM1 SY0AAB47YF21FM1
SY0AAB47YJ20FM1 SY0AAB47YP15FM1 SY0AAB48YH10FM1
SY0AAB48YH14FM1 SY0AAB48YH15FM1 SY0AAB48YO24FM1
SY0AAB48YP19FM1 SY0AAB49YF20FM1 SY0AAB49YJ21FM1
SY0AAB49YM04FM1 SY0AAB49YM24FM1 SY0AAB49YP02FM1
SY0AAB49YP10FM1 SY0AAB49YP12FM1 SY0AAB49YP20FM1
SY0AAB4YP14FM1 SY0AAB50YC12FM1 SY0AAB50YD23FM1
SY0AAB50YH02FM1 SY0AAB50YP08FM1 SY0AAB50YP09FM1
SY0AAB51YC18FM1 SY0AAB51YC20FM1 SY0AAB51YG24FM1
SY0AAB51YH13FM1 SY0AAB51YH24FM1 SY0AAB51YN05FM1
SY0AAB51YO06FM1 SY0AAB51YP23FM1 SY0AAB52YF18FM1
SY0AAB52YH18FM1 SY0AAB52YO10FM1 SY0AAB53YB21FM1
SY0AAB53YL05FM1 SY0AAB53YL19FM1 SY0AAB54YC04FM1
SY0AAB54YD03FM1 SY0AAB54YD13FM1 SY0AAB54YE17FM1
SY0AAB54YG11FM1 SY0AAB54YL18FM1 SY0AAB54YN17FM1
SY0AAB54YO06FM1 SY0AAB54YP20FM1 SY0AAB55YB23FM1
SY0AAB55YL18FM1 SY0AAB55YP09FM1 SY0AAB55YP23FM1
SY0AAB56YA13FM1 SY0AAB56YB07FM1 SY0AAB56YC11FM1
SY0AAB56YF14FM1 SY0AAB56YH22FM1 SY0AAB56YI04FM1
SY0AAB56YI13FM1 SY0AAB56YL22FM1 SY0AAB56YM08FM1
SY0AAB56YO15FM1 SY0AAB57YI14FM1 SY0AAB58YA14FM1
SY0AAB58YL20FM1 SY0AAB58YM08FM1 SY0AAB58YO03FM1
SY0AAB59YC11FM1 SY0AAB59YE07FM1 SY0AAB59YF12FM1
SY0AAB59YG21FM1 SY0AAB59YH16FM1 SY0AAB59YI14FM1
SY0AAB59YN23FM1 SY0AAB5YG12FM1 SY0AAB5YH08FM1
SY0AAB5YJ06FM1 SY0AAB60YB01FM1 SY0AAB60YC07FM1
SY0AAB60YC15FM1 SY0AAB60YE16FM1 SY0AAB60YF10FM1
SY0AAB60YH19FM1 SY0AAB60YJ11FM1 SY0AAB60YK18FM1
SY0AAB60YL01FM1 SY0AAB60YN19FM1 SY0AAB60YP13FM1
SY0AAB61YD08FM1 SY0AAB61YI05FM1 SY0AAB61YL02FM1
SY0AAB61YN07FM1 SY0AAB6YD13FM1 SY0AAB6YG19FM1
SY0AAB6YP08FM1 SY0AAB7YB09FM1 SY0AAB7YB20FM1
SY0AAB7YE11FM1 SY0AAB7YG14FM1 SY0AAB7YH07FM1
SY0AAB7YJ02FM1 SY0AAB7YO17FM1 SY0AAB8YC22FM1
SY0AAB8YD18FM1 SY0AAB8YF07FM1 SY0AAB8YK01FM1
SY0AAB8YP02FM1 SY0AAB9YC12FM1 SY0AAC11YE14FM1
SY0AAC15YA19FM1 SY0AAC16YF06FM1 SY0AAC17YF08RM1
SY0AAC21YD12FM1 SY0AAC26YI19FM1 SY0AAC26YI19RM1
SY0AAC2YO11FM1 SY0AAC36YO14FM1 SY0AAC37YE11FM1
SY0AAC40YM01FM1 SY0AAC49YG14FM1 SY0AAC49YJ06FM1
SY0AAC51YI24FM1 SY0AAC52YD10FM1 SY0AAC53YJ22FM1
SY0AAC60YP01FM1 SY0AAD12YE11FM1 SY0AAD2YM22FM1
SY0AAD31YD19FM1 SY0AAD33YJ03FM1 SY0AAD51YL15FM1
SY0AAD56YL01FM1 SY0AAD62YM02FM1 SY0AAD63YO22FM1