Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1983
Length(NT) : 1071
Best Gene Model Blast : Link to GSTUMT00007537001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: pyruvate dehydrogenase E1 component beta subunit, mitochondrial precursor
Accession: ref|XP_001537310.1| Score: 1130 E_value: 1e-121
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g117 Score: 1119 E_value: 1e-120
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0524 Score: 1227 E_value: 1e-135
PFAM Definition: Transket_pyr, Transketolase, pyrimidine binding domain. This family includes transketolase enzymes, pyruvate dehydrogenases, and branched chain alpha-keto acid decarboxylases..
Pfam Number: pfam02779 Score: 408 E_value: 2e-40
Swissprot: P32473|ODPB_YEAST
Gene Ontology:
GO:0042645 = Cellular component: mitochondrial nucleoid
GO:0005967 = Cellular component: mitochondrial pyruvate dehydrogenase complex
GO:0004739 = Molecular function: pyruvate dehydrogenase (acetyl-transferring) activity
GO:0006090 = Biological process: pyruvate metabolic process

Sequence:
>Contig1983
TTGGTCTCCCTCCTCCGACTTGATACCCGGCATCTGTTTACCGCTACCTA
AAACATTATCGCCAGCATGTTTGTAGCTAGGAATTTCCTTTCCCGCGCTG
CCGGAAATGCTCTCAGAAAGCCCCTTGTCAACATACACCGAGTAACTGCT
TTTCAAGCTTTGAAGGCAGAGCAAAAAAATTATTCCACTGGCGGTACGAG
AGATTATACGGTAAGGGAGGCTCTGAACGAGGCGCTTGCCGAGGAATTGG
AGAGGGACGAGAAAGTACTTATTATGGGCGAAGAAGTGGCCCAGTACAAT
GGGGCTTACAAAGTCACCAAGGGATTGTTGGATCGTTTTGGCGAAAAGAG
AGTTATCGATTCGCCAATTACGGAGCACGGTTTCGCTGGTCTCGGTGTTG
GTGCCGCTCTCGCTGGCCTCAGCCCTGTGGTTGAATTCATGACTTGGAAC
TTTGCTATGCAAGCAATTGACCAGATTATTAACTCTGGAGCTAAGACACA
TTATATGAGTGGAGGCATCCAGCCTTGCAGCATTACTTTCCGTGGACCCA
ATGGATTTGCTTCTGGTGTGGCGGCTCAACATTCTCAGGATTACTCTGCC
TGGTATGGCAGCATCCCGGGATTGAAAGTAGTTACGCCCTGGAGTGCGGA
AGATGCTAAGGGTCTGTTGAAAGCTGCTATCAGAGATCCCAACCCAGTAG
TGGTTCTTGAGAATGAGTTGCTTTACGGACAGGCGTTTCCTATGTCAGAG
GAGGCTCAGAAGTCTGACTTTGTCCTACCTATCGGAAGCGCTAAGATCGA
GCGAGTTGGAAAAGATGTTACTCTTGTGGCGCTCTCCCGCTGCGTTGGAC
AAGCTCTCACCGCGGCGGCGACTCTAAAGAAGAAATATGGAGTCGAGACG
GAAGTTATTAACCTCCGTTCCGTTAAGCCTCTTGATGTTGAGACCATCGT
GAAATCTGTCAAGAAAACCAATCACCTGATCGCCATTGAGAGCGGCTTCC
CCAGCTTCGGGGTTGCCAGTGAGATCCTTGCTCTGAGCATGGAATACATG
TTTGATTTCTTGGACGCCCCG

Sequences in the Contig:

SY0AAA50YD11FM1 SY0AAB11YD08FM1 SY0AAB42YJ13FM1
SY0AAC44YM16FM1 SY0AAC58YP06FM1 SY0AAD19YA02FM1
SY0AAD49YA19FM1