Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1899
Length(NT) : 539
Best Gene Model Blast : Link to GSTUMT00008448001 E-value : 1e-178
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1899
TTGGCTTTCTCACGTTAACAGGGCTTTGCGCATCTTCTAATTCCTCAAAC
CACCGCTTCACTCCTTCAGCGGGCATTCTTTTCTGCTCTAATCTCTCTAT
CCTATATACCCAACAATTAACATTCCTCCATTTTTCTCGAGATTGTCCCT
CCTGGAATTACTCGCGTGTTGTTGATCGACGATTAAAGAGATCATCTTTT
TTCATTTTCCACTTCGTTCTTCAGTATGAGGTATTCGTTGTTCGCCGTCG
CGGCTACTGCTTTGCTTTCTGGTTCGGCCGCCGCTCGGGGGCACCAGCAC
CGCCGCCATGCCCACCCACATGCTTTGGCTCCCCGTGGTGAGTGTGAGGT
TAGTCCTCCTCAGTGCAAAACCTACACCAGCTCAATTTTGGTTCCTGTTG
GAACTGTACCACCAAGTGATGCTTCGACCGTTAAGCAGACCATGACCGTG
GTCCCGGTTGTTGAGCCAACCACCACTATCAAGACCACAGTGACATACAC
ATCCACCTCAACCAATGTGGTTACTGTCACTAAGCCCAA

Sequences in the Contig:

SY0AAA56YE23FM1 SY0AAA8YA09FM1