Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1896
Length(NT) : 840
Best Gene Model Blast : Link to GSTUMT00010305001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SNOG_06141
Accession: ref|XP_001796525.1| Score: 192 E_value: 5e-13
KEGG Definition: deacetylase complex subunit Sds3, putative
Accession: afm:AFUA_3G13150 Score: 151 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1896
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCTTTGAGTTAGCCTCCTC
TCACCCCCATCGCTCAACCTTCCTCCGCTTCCCTACTCTCGCCGAGCTCT
TGAGGATTTCTCACCAAGATATAGTAGGCCACCCCTTCAAACCGAAAAAC
TTTTACTCTAGGCACATTTTCAACAAACCGAAAGGGCTCTCCCCTTCCGT
TAAGCTCAAAACTTTCATCTCCATTCCAATTCGACCTCACCTCGCCTCAA
CACTACCAACACGCCATCCGAAATGGCATCACCATCACCAAGTCCCCCTT
CTCTTTCACCTACTCCTCATCCCAATCAGCTCCCCCCACCAACTGCTCCT
CCCCAGAGCAAACGCGATAAACGTAGACACGCCTTGAGCGAAAAGCTCAC
TGCCCTCACGACATCGTTCCATAATCCTACTAACCCCCTTGTGCGGGACC
TACACTACCGAGCACAACTTGCGTCTATCCAGGCTGATATCCATCTAATC
ACCAAATGCGATGCTTCTGGACGGGATATGCGGCTCTTGGATGATTCGCC
GGAGCGTATCCAGGTGCAAGTTGATGAGGAGCTTGAACGGATGGGTTTAT
CCGACCTAGTTTCTTCTGCCAACGGGGCGAGGGCTGGAGCCGGTCCTGGG
GCTGCGGGCAAGGAAGATGCGAGCGGAGTGGGAGTTACGGGAATGGCAGG
AAGATGGTATGGACATTTTATTGAGGCTGTGAATGAGGGGATGGAGGAGA
GGGATGCTCAACTTTCTCTGCTTCACAACAACTATAACCATAAAGTAGCA
TCCCTAGAATTCCAACACAAGCGCTCAATAGTCCTCGCTA

Sequences in the Contig:

SY0AAA54YI20FM1 SY0AAA7YP16FM1 SY0AAC37YI23FM1
SY0AAC57YP23FM1 SY0AAD17YC12FM1 SY0AAD17YI12FM1
SY0AAD31YA19FM1 SY0AAD40YI21FM1 SY0AAD57YB20FM1