Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1895
Length(NT) : 1143
Best Gene Model Blast : Link to GSTUMT00005708001 E-value : 6e-57
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1895
TTGGCATCAACGCCGATTTATGTGGGGGGGAGTACAATATCTTACGAAGA
GAAGTGTATGTTAGCCGTTCCAATGCTGAATAACAAATAAAGTTTAATGA
CTTGTGTGGAGAGGTAGGAGTTGGAGGAACTAGAGTGGGTACGTGAACGG
GATCGGCCACGGTGTTGGGGCGAAACAACTGCTGATTTCTGGCTCGCGAG
TGTTGTAGCAGGTGTCGCCGGTAAGGGAAGAGAATCAACCACGATTTTAG
GGCGAAACAACTGCTGATTTCTGGCTCGTGAGTGTTGTAGCACGAGGGGT
TTGAGCGGTTTCTGCGAACCATTAATGTAACTATTGCGAACTCCTATATC
GTTCCTCCTCACACAGCTAACTAATTTCTCGTCGCTTTACTCAGTTTCTC
GTTTGTCAACCTCTTCTTCCTCCTTCCCGCTTCTCCCACTAACGCTTAAT
CCTCCTTACAACCATTGGGTAACCTAGAAAGTGCGTAATATGATTTTATT
ACCACCGGTCACGTAAGCGCTGGATATCTGTTAACCTTTCCCGTAGGCCG
TGGGTCGCTCCCGTTTGCTATCCTTACCTTCATTGCAGATTATTATTTAC
CCCCCAATAGTTTTGCCCCGTGGACACCCCAGGCCCGAGCACACTAGATC
CGGGTACTCCAGACCCGGGCACGCCGGACACGGCCACTTCAGACCCGGGC
ACGCCAGACCCACGCACACCAGACTTGCGCACACCAGATCCAAGTACGCC
AGAGCCACGCACGTCAAACCCGCCTACGCCAGACCCGGGTTCTCCAGATG
AGCACACTACCCCCTGCTGCGGCAGCTGCTCCTTGTGCTAGGGGCTCGTA
TCACGGCTGACCAAAGCGGGTCATTGGTTGGAGGACCGTCATTCGTTCAG
TGGATCCACTGGCTCGGGACTACGCCTATTTTTTGTTCACCCTATGCTAC
TGTCATCAAAATTTGTTTCAGCGAGGAGTATGATATTTGTGTAGGATGTA
GAAGTTTGTGGGAGCCAGCTCTAAGTGGCGTGTGGTGTATCTGTTACTTC
TTTCCTGGCGTCTTCAGAATTCAATTACTCGTTACCAACATGGATCTCAA
AAGTCATAAAATAGCAACCAAATCACCAATAAGATGGCTTGAT

Sequences in the Contig:

SY0AAA23YA03FM1 SY0AAA25YM12RM1 SY0AAA7YO12FM1
SY0AAB5YD02FM1 SY0AAC19YA06RM1