Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1894
Length(NT) : 1137
Best Gene Model Blast : Link to GSTUMT00004003001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: C2H2 finger domain protein
Accession: ref|XP_752117.1| Score: 490 E_value: 2e-47
KEGG Definition: C2H2 finger domain protein, putative
Accession: afm:AFUA_4G07090 Score: 490 E_value: 1e-47
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2462 Score: 118 E_value: 8e-07
PFAM Definition: No Hit Found
Swissprot: P15619|SRYC_DROME

Sequence:
>Contig1894
TTGGCGCAACTCTGGCGACAACGCAAGTGTATCGTCATTTATGACAGATA
ATGAGAGCTATCCAAATGCAGATTCACGGATGCGTCGATCGAGGAGTGCT
TCTATACTTGCGTCTGGCTATGACGATACTCCATCAAGTGGTTGCGATTT
ATATCAGGAAGACACTGATTCGCAAATGGATGACGCGCCTTCTCATGTTT
CCCAAATGAAGCGGCTTACACTTGGAGCAAGGACACCGCCAAAGTCAAAT
TCTTATCCTATTAACCATCACCATCACAGCTGGTTCGAAAAGGCGAGCTT
CATCGCCCCCAAATGAGGATAGGCAAATCGGAAGCTCGGAGCCTACTAGA
AAAGGTCTACATTTGGAAGGTTATGGGAGCGGCGATATTTATGACCACAG
TCGGAGAACATCACCAATACACCAAGGATTAAGGAACTCGCCAAAATATC
AGCATTTTAATAATTCACCAATTCCCAGATCAGCATCAGGATCATATGCG
TCTACTTCTATATCATCTGCGACAACATGGCCTGCATCCCTTGGTCAATT
TTCTGCTGCAAGTAGCTTTACTACGGCTGGGGGTGTCTCACCAGCTTCCT
CATTTTCCCCACAATTAGAGATGGATATTGTCGGTGACCCACCATTTCGG
CAACCGCCGCCCTCAACGAGCGCAAAAGGGCCTAGCAGTAGTAGTAGGCA
CAGACAAGTTCCAGAGGCGTCCTCGGCACTTAACGGCAGAGAGAGAGAGG
GTATTGCTTCAAAGCACCATTCAGCCCCGAAAGTGGGTGTATACATGTGT
GAATGCTGCCCTAAAAAGCCGAAAAAATTTGACACTCAGATGGAATTGCA
ATTGCATGAAATGGAGAAGCAGTACGGCTGTCAATATTGCAATAATCGGT
TCAAGAATAAAAACGAAGCAGAAAGGCACCAGAATTCACTGCATCTACGG
AAACACTCGTGGTCGTGTGCGGCACTCTCAAGCAATTACCCGGCAGCGTT
CCACGCTTCCCCTCAACACCCGTCCACTTGTGAAATATGCGGTTATTGTG
GGAAAGAATTTCCGATGCCACCGCAATGGGATCAGCGAATTGAACATTTG
ACCGGGGAGCACAAGTTTGGAGAATGCAATCAGTCCA

Sequences in the Contig:

SY0AAA40YP07FM1 SY0AAA7YO01FM1