Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1893
Length(NT) : 1649
Best Gene Model Blast : Link to GSTUMT00012245001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: L-galactonate dehydratase
Accession: gb|ABA60340.1| Score: 1524 E_value: 1e-167
KEGG Definition: hypothetical protein
Accession: ncr:NCU07064.1 Score: 1462 E_value: 1e-160
KOG Definition: No Hit Found
PFAM Definition: MR_MLE, Mandelate racemase / muconate lactonizing enzyme, C-terminal domain. C-terminal domain is TIM barrel fold, dehydratase-like domain. Manganese is associated with this domain..
Pfam Number: pfam01188 Score: 228 E_value: 2e-19
Swissprot: P11444|MANR_PSEPU
Gene Ontology:
GO:0018838 = Molecular function: mandelate racemase activity

Sequence:
>Contig1893
TTGGCGAAAGACGACCTCACTTCGTTTCACCCACAATTCCTTTCACCCCC
TCCCCTCTCTCTTCTCAAACCTTGGTATGCCTCCATACCGCGCAAGGACG
TGTCTCTGACATGGCCATCCTCAGCTTTACGGAGCTCCTGCTACTCGAGT
TCCTGGCGCACTTATCCCACGCTAACCTCTCCCTCGCGCACCGCTGGCTT
CGGGACAGTTCCTCCGAAACCCGAAGCGGAATGGGGCGTTCTCGGTGCAA
ACCACCACGAGACGCCTAGGTTTTGACGGGAACGGGAGAAAATGCCAGCA
AAACAAATCAATTACTTAGAGGGGAAACTTGGAAGCCCTGAGACAAATCG
CTCTTTATCCCAGTTAATACAGTATCATAGCTGGCTCTTGACGCGGTGGG
GTAGGGTGGGGTTGTTGCCCTCCAAACGCATCCCGATAAAAATAGCCATC
GTGGAGGTCTCCTCTCGCAATAAACCAGCGACAGCGAGCAATCGACCTCA
CCACCAACTGCTACTTATCAAAATGGTGCAAATAATCGCCTACGAATCCC
GCGATGTCCGCTTTCCGACTTCCCTCGACAAAACCGGCTCCGATGCCATG
AACGAAGCAGGCGACTACTCGGCCGCCTACTGCATCCTCAAAACCGATGG
AGCCCACAGCGGCCACGGAATGACCTTCACCATCGGCCGTGGAAACGACA
TTGTTTGCCGTGCGATCGAGCAAGTGGCCCAGCGCATCGCCAGCCACTCG
CTAGAAAGCCTGACAGCGGACATGGGCAAGACGTGGCGATGGCTGGTATC
CGATTCGCAGTTGCGCTGGATCGGACCTGAGAAGGGAGTTACCCACCTTG
CCCTGGGTGCCGTCGTGAACGCACTTTGGGATCTCTGGTCCAAAGAAGTT
GGGAAGCCTTTGTGGAGGTTGGTGGCAGATATGTCACCTGAGGAGTTTGT
TAGATGTATTGATTTTAGGTACATTACTGATGCGATTACTCCCGAAGAGG
CGGTTGCCATATTGAGAGAGGGGGGGAGCGGGAAAGAAGGGAGGATTCGG
GATGCCCTCGAGGATAGGGCGGTGCCGGCGTATACTACATCCGCAGGCAT
GATCCTTTTCGCTGAGCTCACTGGATCGGGAGCTAATTTTGATATAGGAT
GGTTGGGATATGGTGAGGATAAGATGAAGAGCCTGCTACACGAGACGTTG
GCACATGGATATAAGCATTTCAAGATTAAGGTTGGAGGAAGCGTGGAAGA
GGATAGGAGGAGGCTGAGAACCGCCCGTGACATTATTGGATATGAAAAGG
GAAATGTCCTCATGATCGATGCAAACCAGGTCTGGTCCGTCCCAGAAGCA
ATTCACTACATGAACCAACTCGCAGAATTCAAGCCTTGGTTCATCGAAGA
GCCCACCTCCCCCGACGACATCCTAGGCCACGCTGCGGTCCGAGAAGCTC
TAAAACCCCACGCCATAGGTGTCGCTACCGGCGAAATGTGTCAAAACCGT
GTGATGTTCAAGCAGCTCCTGCAGGCCCAAGCAATTGACGTTTGTCAAAT
CGACGCGTGCAGAATGGGCGGCGTGAACGAAGTTCTGGCAGTCCTTCTCA
TGGCGAAGAAATTCGGCGTTCCCATCGTCCCGCACTCCGGTGGCGTGGG

Sequences in the Contig:

SY0AAA10YD13FM1 SY0AAA16YG22FM1 SY0AAA31YB19FM1
SY0AAA55YA11FM1 SY0AAA6YD01FM1 SY0AAA7YN20FM1
SY0AAB28YF01FM1 SY0AAC44YA16FM1 SY0AAC53YG21FM1
SY0AAD14YE14FM1