Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1892
Length(NT) : 1098
Best Gene Model Blast : Link to GSTUMT00009536001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: cell wall anchored protein, putative
Accession: gb|EDP56614.1| Score: 145 E_value: 2e-07
KEGG Definition: cell wall anchored protein, putative
Accession: afm:AFUA_1G13760 Score: 145 E_value: 1e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1892
TTGGCGCCTCCATTGTTTTTCACTTTTACCCATGCTAGCCGCCTTCTTTC
ATTCTTTCCCCCTTACTGTAGCTTCCCTCTGATATTGTTGTTGAAGCCTT
CGCTGTTGAGAGTGGCTAGTTTGCGAGCCGGGGTGAGCTACAGTGTAGGG
AGGAAGCAAGCAGGTGAGCCGGCAGTGATTGGGTACAACGCACTCAAAAC
AAAATGTCTGATACTGCGGCCTTTGATCAGCACTTCTTCATACGATGCGC
TCATTAGTAGCGGGGTTGCTGCTATGGCTTTCCACCATAACCGGTCTGTC
GGTTTCTCAGTCTACTTGGACGTTGGATCCTCAGAAACACCTCGCACTGA
TGTTCAATCATATGTCGGTTATGGTCAACAGTACGATATACACCATCGGA
GGAACAGCAATCTACTGGACTCCGCGCTCGACCGCCTCCTCAATAGTCTC
TAACAACAATAATTCCGTTTATATCCTAAGAGCAGCTAACTCGTTCCTTC
GAGCCCTCGACCTCTCGAAACCTGCCGATTTTGAAGCCCAATTCTCAGAC
ACAAGCGAGGTGATATCCGAGCTCCCCTTCGAAATCCCACACGTCAAACG
CGGTGCGGCCTGGGCGTACCAGAATACAATATACTACTGGGGTGGAGAAC
TGGAGTGGGAACCCGTATACATGAACGGGGCCTTCCAGAATAGGATAAGG
GAGTTGCCAGACCCCATGAAGTACTACACTTATGACCTCGGTCAACCGAG
GGGGTCCGGGGTGTGGAAAACCGTCTCGATCCTGGAGGCTGGGGGGTCGG
ATACGCTCACCGGTTCCCCGAGTTATGGTGAATATGCTTACTCTACTGAG
GCTAGGAAGGGGTTCTACCTTGGGGGAGTTGTAGGCAGGTATGGGTTAAT
AAATAAGGATGGATCGAATGCGACCACTGTTGCCACTAATTCCTCCCGCC
GTATGAACTCGATGGTCGTGTTCGATCCTGCGACGAATGTGTGGAAGAAC
CAGACTGTGATTGCGGTACTTAATGACTTGCGGGAAGGGGTTCTGGTGCA
TGTTGCAGGTGTTGGGGAGAAGGGTATACTGGTTAGAATGGGGGGAAT

Sequences in the Contig:

SY0AAA35YI19FM1 SY0AAA7YN09FM1 SY0AAB30YN15FM1
SY0AAB7YH04FM1