Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1891
Length(NT) : 749
Best Gene Model Blast : Link to GSTUMT00009493001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: MIP-2A
Accession: ref|XP_001557147.1| Score: 480 E_value: 2e-46
KEGG Definition: trafficking protein particle complex subunit 2, putative
Accession: mgr:MGG_06294 Score: 452 E_value: 1e-43
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3487 Score: 441 E_value: 1e-44
PFAM Definition: Sedlin_N, Sedlin, N-terminal conserved region. Mutations in this protein are associated with the X-linked spondyloepiphyseal dysplasia tarda syndrome (OMIM:313400). This family represents an N-terminal conserved region..
Pfam Number: pfam04628 Score: 429 E_value: 3e-43
Swissprot: Q3T0F2|TPPC2_BOVIN

Sequence:
>Contig1891
TTGGCAAACACCTCAAAGCTTGCAAACAAGAAACTATTCGATTCCACCAA
TTTCCCCCCTTGTTACTGCGAGCAACACTTGAGCATATCGAAATGAGCTT
CTATTTTGCTATTGTCGGCACAAAAGATAACCCAATTTATGAAGCCGAAT
TTGGGACCTCAAAGCAAGGTGGCGATGGCGTAGCTCGATTCCGCGAAGAG
CAACGTTCTATGAACCAGTTCATCGTCCACTCGAGCCTTGACATAGTTGA
GGAAGTCCAGTGGGCGACTCCCACAATGTACATGAAATGCGTTGATAAAT
TCAACAATCTTCAAGTCAGTTGTTTTCTGACCGCCGGAAATATCAAATTT
TTATTGCTCCATGATCAGAAAGCGGATGATGCAATTCGTCAGTTCTTCAC
AGATGTGTATGACCTTTACACAAAAACACTTATGAATCCATTCTACGAGG
TCGATATGAGGATCACTAGCGGGGTGTTCGATGGAAAGGTTAAGCAGGCT
GCCAAGAAGTACCTGTGAGGAGTTCTTAGTAACATCTGACGATTCATTGA
CGGTTCATGGCGTTCTCGGAGCTTAGGTCAAGTTATAGATATGAAATCGA
CCATATTTGGGATATGATCAACTATGGGAGCCCAGGTCTCGATTCTCCTT
GAAGCAAGGTTTTAAGCGATTCATGTATTAGAATACTGGCCTTTTTTTTA
AAGTCTCCGGAGTGGGAAAAAAATATGTGATTCAATTATAGTGTAACTG

Sequences in the Contig:

SY0AAA7YN07FM1 SY0AAB47YO07FM1 SY0AAC58YM12FM1