Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1890
Length(NT) : 662
Best Gene Model Blast : Link to GSTUMT00005268001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CHGG_03208
Accession: ref|XP_001229724.1| Score: 512 E_value: 2e-50
KEGG Definition: hypothetical protein
Accession: ang:An17g01740 Score: 505 E_value: 8e-50
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2014 Score: 492 E_value: 2e-50
PFAM Definition: ThiF, ThiF family. This family contains a repeated domain in ubiquitin activating enzyme E1 and members of the bacterial ThiF/MoeB/HesA family..
Pfam Number: pfam00899 Score: 191 E_value: 1e-15
Swissprot: Q06624|RHC31_YEAST
Gene Ontology:
GO:0031510 = Cellular component: SUMO activating enzyme complex
GO:0019948 = Molecular function: SUMO activating enzyme activity
GO:0016925 = Biological process: protein sumoylation

Sequence:
>Contig1890
TTGGCTGCGCAATAACAAATCCAATTCTAGAAAACCACCAGCCTAATCAC
CCCCAAGCCCACCCACCGGTGCTCAGAAACACCCTCTACCTAATATTGTT
ATGGCCCCTTCAATCACAGACAACAACCTTTCCATCCCGGATGCCGGCTC
TGCGTCGGAGGTCACAGTCGCATCTGTCGCAGAAGCTCAAACCATCTCCG
CAGACGAAGTAGCTCTCTATGATCGCCAGATCCGACTATGGGGAATGGAA
GCTCAGGCTAGAATGCGCAATGCCCACATCTTAGTAATAACCATAAAAGC
CCTCTCCAATGAAGTTTCGAAAAACCTGGTTCTTGCTGGAATTGGCTCTT
TAACGGTCCTAGACCCCGGAATTGTTACCGGGGAGGATCTGGGCTCGCAG
TTCTTCATAAGTGAGGAGAGTGTTGGCTTGAATAGAGCGGAAGCGGCAGC
ACCGGCGTTGCAGCGATTGAATCCGCGTGTAGCGGTTAACATAGATACTT
CGGACCCTAGGGGTAAAGATGCTGAATTCTATGGCAAGTTTGACATTGTT
ATTGCGACGGAATTGGACCTTGACTGTTTGATACACGTGAATGATATTAC
CCGTGAGTGTAATCGTCCTTTCTACGCCGCGGCATCATACGGGATGTACG
GGTATATCTTTG

Sequences in the Contig:

SY0AAA7YN06FM1 SY0AAB57YH11FM1 SY0AAD11YM17FM1