Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig189
Length(NT) : 1143
Best Gene Model Blast : Link to GSTUMT00005014001 E-value : 1e-138
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig189
TTGGAGAATCCCGCATTGGTTTATCGGATGGCTTTCAGAGGTGGAAGTTG
TAGCAGTACGAGTATCGTGCACGAATCCGCAGCTCAATCGCGGGTCATCG
GTGTGCACGTTTGACTTGTATTTTCTCCGCCTTGTCTTGTTTTATCCTCT
TCTTGACGTGATACGCACATACGGGATGGACGTTCCGGATTGAGCGAACT
ACAGATCATAATATTATATCATATCTTCTATATTTTTGGTCGGCATGTAT
GGCATTCTGCGCTCGCTCTGTATTTCAAGTCAACATGATTCGTGGGTCGA
TGTTTGGACAGGAAGCTGTTTTCTTGGCGATGCTAGTTATAGGCTTGCAT
TCTTCTCCTTGTGGATTACCCGAGCCACAAGCGGAGGCGGTTCTCTGGGG
CTCTTGGCAACAACACTCATTTATGAATCCAGTAAGATGGAACGGTTATT
GTTTGCGCTGGGGCCTTAAGGGTTTCCGGGATGGTCAACTTTGGGTGGCT
TATATGTAGGGAGAAGTGTGAATACGGCTGGCGTTTCCACTCTTCTCGAC
TGGGAGGGACTTAGGGGGTGAGCATACGAGAGGTGATTTCAGGCTTCACT
GGCCAGAATTTGTTCAACTGTACCGCCGCTCTCTGTGCGGCTCAAGTGAC
CGTCGAACCGATCACACATAGTTAGTCTACCTCAAGCGCCGGTACTGCGC
AGTATAGCAGCATGGCACTTTCGCAGGGTGCAGACATCAGAAGATACCGC
TTCAGCAGGATGTGGCAATGACCTCTGCTGGGAATACTCCTACTGCTCTT
TGGCGAGTGGGGGCTCCTAAACTGGCACTAATCACCCTATAAGCCACAGA
AATCTTTCGCCGTAAAATTTTGAATAATTGGACAGTGTGCTGTGTAATCC
GGGGTTCCTTTCCCTGGAAAGGAGGCAAGAAGCTCAACAAGAACATAGCC
CCTTCCTCCTCTGAAACAGAATCTTTTTTTTTTCCTCTTGACCTTACTGG
GGGGAAAGCTCGAAAACATAGTGCACCATCCAATTGTTTGTGTGTAATGC
GATAATCACTCTATGGACAGAACAGAAAAGGGCCAACCCACCCACCACAC
CTGATCTCTACGAATGCACTTTTCTTTCCTTTTCCATAGGAAG

Sequences in the Contig:

SY0AAA16YN09FM1 SY0AAB45YF09FM1 SY0AAC4YN14FM1
SY0AAD1YO10FM1