Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1889
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00009884001 E-value : 1e-127
Numbers of ESTs : 2

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 391 E_value: 3e-36
KEGG Definition: hypothetical protein
Accession: ani:AN8767.2 Score: 366 E_value: 1e-33
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 296 E_value: 7e-28
PFAM Definition: Ank, Ankyrin repeat. There is no clear separation between noise and signal on the HMM search Ankyrin repeats generally consist of a beta, alpha, alpha, beta order of secondary structures. The repeats associate to form a higher order structure..
Pfam Number: pfam00023 Score: 107 E_value: 7e-06
Swissprot: Q8UVC1|INVS_DANRE
Gene Ontology:
GO:0010171 = Biological process: body morphogenesis
GO:0001822 = Biological process: kidney development

Sequence:
>Contig1889
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGACGACGAACACTGGAGA
GAACACAACCGCGACAATAACCAGTTTCTTTTTCTCTTTTATTTTTACTT
TTTTCTAAGGGCTAGCAAAACTCGCCAAGTGCTTGTGTTCTCCTTCCTGG
CCCGCCTTTTTTATCTTTCCACCAGGGAACTGCTGTTTGAGCAAGAGGAC
GCCGACTCCGATATGTTATACCCCTATATGCCACACAATCATGGTCGAAC
CCCGCTCTCTTGGGCTGCTATGTGTGGGCATTATGAAGTAGTAAAGCTAC
TGTTAGAACGGCAGGATGTGGACCCCAACAGGCCAGACCGTACGGGCCAG
ACACCACTCTCGTTGGCTGCTGACAACGGGCATGGTGGGGTAGTCGAGCT
GCTACTAAAAAGGGGAGACATCGATCCCAATCTTCTAGACAATTTTCGCC
AAACACCGCTTGCGTACGCTGTCATGGAGAGGCACTATGAGGTAGCGACG
CTACTGCTAGGACGGGGAGACGTGAACCCCAACATCCGCGACGGTGATGG
CCTAACGCCGCTCTTTTGGGCTGCGGAGTGTGGGTATGACGAATTAGTGA
AGCTGCTTTTGGAACGTGAGGATGTCGACCCGAATATACGAGATATTGAT
GGCAAAACGCCGCTTTCCCTTGCCGCCAAACAAGGACATGATGAGGTAGT
GGA

Sequences in the Contig:

SY0AAA36YG19FM1 SY0AAA7YN04FM1