Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1888
Length(NT) : 745
Best Gene Model Blast : Link to GSTUMT00003152001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: 26S proteasome regulatory subunit Mts4, putative
Accession: ref|XP_001274467.1| Score: 547 E_value: 3e-54
KEGG Definition: 26S proteasome regulatory subunit Mts4, putative; K03028 26S proteasome regulatory subunit N1
Accession: afm:AFUA_5G11720 Score: 543 E_value: 4e-54
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2005 Score: 559 E_value: 3e-58
PFAM Definition: No Hit Found
Swissprot: Q7S8R8|RPN1_NEUCR

Sequence:
>Contig1888
TTGGTCCATCCATCCCCGTCACCAATAAAACCCCCAACAACCCTATCACC
ACAAATCCCATCATCAACTAAATTACTATCGTTTTCTCTCCTACCCGCTC
CTCATCGATTAACATTAGCTCTAACCGCTATGGCAAAGGAGAACGAGAAG
TCGACCAAACTCGACAAAGGCAAAGGGAAGGCCGCAGATACCCCCGAAAA
GAAGGACGGCGATGCCTTTAAGGAAGCACAGGAGAAGAATGGGAATGGAG
TAAAGAAAGGAAAAAAAGATGAACTCCAAGAAGAAGAGCTCTCGGAGGAA
GACCAACAGCTGAAATCAGAGCTGGAAATGCTGGTCGAACGGTTAAAGGA
ACCCAATGCCGAACTCTACAAACCTGCGTTGGAAGCTATCAAAACCTTTA
TCCGAACATCGACTTCCTCCATGACTGCTGTTCCCAAACCTTTGAAATTT
CTACGCCCCCATTACAAGTCTCTTACAGAACTTTATGAGCAATGGCCGGA
GGGCGAGAATAAGGTTGCCATGGCCGATGTTCTTTCCGTTCTCGGGATGA
CATACGCAGACGAGAACCGACTGGATTCGCTCAAATATAGACTGCTGGCC
CCTATGGAAGACCCCGGTTCGTGGGGTCACGAATACGTCCGACATTTGGC
CTTGGAGATCGGTGCAGAGTTCACTTCGCGCCAAGAAAGGGAAGAAGATA
CACAAGACTTGACTGGCCTAACAATGTCCCTCATCCCGTTCTTTC

Sequences in the Contig:

SY0AAA58YF09FM1 SY0AAA7YM18FM1 SY0AAB8YN07FM1
SY0AAC22YH05FM1 SY0AAC3YP02FM1 SY0AAC49YH08FM1
SY0AAD21YA04FM1 SY0AAD51YB18FM1