Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1885
Length(NT) : 1997
Best Gene Model Blast : Link to GSTUMT00007218001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61011.1| Score: 891 E_value: 1e-93
KEGG Definition: predicted protein
Accession: aor:AO090012000910 Score: 891 E_value: 7e-94
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q93XX5|Y5713_ARATH
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig1885
TTGGCCTCACTCCTCACCCCTTTCCCACAACTCTTAGCAGGTTTGACTCT
ACACTCCATGCACCATACTTGTCATATTCAACCCTTCGCTTCCCTTCGGT
CCACCTGCTTCCCTGAAACCTCTGTTGCGATCGTTGCCATTTCACAGCAT
TTCCAACAGTCTCGGCCGTTCACTCCGATCCATCACAATGGCCACTTATA
GTCTCGTTCAGTTGTTTGGCTGGCTAATACTAGCCAACATTCCCCTAGTA
TGGTGCCTTCCGGTCAAGGAACGGGGAGGTTACAAGATTTTGAGCGGTGC
TACTTGGACGGGTTCGTCCACATCCGTAGTAGATGGCACTGCCTCTGGAA
CCCCCACTACAGCTCGTCCAAGCCAGGCTACGGCTCCAGCGAGTGCTCTG
CAACCTACAAATACTCAGACCTGCAACTTATATGTCGAGTTTTGCAATCG
GCGGTATAGTGATATAACTTATGTTGGAGCCCATAACTCACCATTTACGG
GCGAAAATAACCTTGCGGTGAATCAAAATTCGGATGTGAAGGCTCAGTTG
AATGATGGCATACGCATGCTCCAAGGACAAACACATAGAGTGAACCAAAC
TATATACTACTGTCATACCAGGTGCGATCTGCTCAATGCTGGGACACTTG
AAGACTATTTAAAGACAGTCGCGAAATGGCTGCGTGATAACCCTTTCGAA
GTTGTCACCATTCTGATTGGGAACGGTAGCTTCCTCAATGTCGGAAATTA
CAAGGTGCCTTTAGAGAAATCTGGTTTGGCGGAACTTGCATACGTTCCAG
AGAAGCAGAGCATCAAAATAGACCAATGGCCAACACTCTCAGAAATGATC
CTGATGGCCGATGAGGACGCCATCCCCTATATTCTGGATGAATTCAAATA
CATGTGGGAAACACCGTTCTCGCCAACGGATGAAAACTTCCCCTGCACGA
TTGACCGTCCTTCGGACCAACCCAAGAATGATACACAAGGAAAGCTATAC
ATGGCGAACCACAATCTGAATACCAAACTGTCAATTTTTGGAAAAAGCGT
CTTACTCCCTAACACTGATAATCTTAATCAAACCAATGGCGTTTCAGGGT
TTGGGTCATTAGGTCTCATGGCAGACAATTGCAGAGCCAACTGGAACCGG
TACCCAAATTTTCTTCTTGTAGACTTCTATGACATCCCCGACGGCTCCGT
CTTCGAAGTTGCTGCCAGAGCAAACAATGTTACATACAGTTCTAGGCAAA
AGGGTTCCTGAATATGCTCAGTCAGATGCCAGTGCCAGTGTTCCCAGCCG
TCCAGTCCGTCCGTCTTCGGCGTCAGGCAGGACGGGCGACGGCTCATAGT
CCGTCTTTTTCAGAGCGCTAGGACGGACTACGCCCGGGAAGGTGAGGACC
GCATGGAATCTATTGGACTATAGTCCCAGCGCTTAGACCTCCGGTGCTAG
CCAAGTTGAAACTGCGCACCAGAAACGATTTACTATGGCCCGCCGTCCAG
CCCAAGGACGGCCCTCCTGCACTTTGACCGCCCTGGATGGACTACAGATA
GCCATCCTGTCTTGTCCAGGGCTCTTGGCACCCCCCCTGGCGGTTAGGAA
TACTGGATGTCACTTATTCTCACGAACACATTTTCCCCGGGACTGCAGAA
TGGTGGATGCAGTGGAAGGAGAAAATCCACTGCCTCACCGCTGGCAAAGG
CCACAAACCAGCTTTTAGTCCTTCCAACTCTCAGGCCGCCTTATCTCTAA
TGTTTTCAGGTCTGGTGGGAAACCGCATTGTGGGTTGCTCCTATATGGAC
TTGCATCAGGGGCTCGGTATAAGGGGAGCTCATTTGCGGCATTTTTTTGT
TTGGGGACAAGGATAGGTATTTATTATTAGGGGTTTATTGTAGGTTAGGT
GTGAGGGAAGTGAAAGAATCGCTCGTGATGGTGGTAATGATGGACACGGA
GTGGAGCACGAAGGTGGGGTGACGGTGTCGGAGAAAGAGCGGACGGG

Sequences in the Contig:

SY0AAA10YF08FM1 SY0AAA18YJ23FM1 SY0AAA22YE03FM1
SY0AAA25YN14FM1 SY0AAA31YH20FM1 SY0AAA34YM04FM1
SY0AAA56YH19FM1 SY0AAA60YG18FM1 SY0AAA7YK17FM1
SY0AAB40YD10FM1 SY0AAB43YG05FM1 SY0AAB4YM16FM1
SY0AAB55YB09FM1 SY0AAB58YC12FM1