Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1884
Length(NT) : 851
Best Gene Model Blast : Link to GSTUMT00004957001 E-value : 0.0
Numbers of ESTs : 32

Blast Results:

Nr Definition: hypothetical protein SNOG_07256
Accession: ref|XP_001797601.1| Score: 276 E_value: 9e-23
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_6G09090 Score: 251 E_value: 4e-20
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 117 E_value: 6e-07
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 119 E_value: 3e-07

Sequence:
>Contig1884
TTGGCCAACTTTTTTGTACAAAGTTATCCCACCATACATCAGTGGAGACA
TTCAGACCACCACCAAAACACCTTCCCGAGTCACCAGTTCATCCCTAACC
AAGCCATGCCCGTCTTAGAATTCGCAATCTACACCCTGCGCCCCCCACAC
ACCCCCGCCTCCCCCACGGTGAGGTCCCTCCTCAGCAACGCCCTAGCGGC
CCTAAACTCCGCCTCCGGCCACTCCTTCATCCTCATGAAACAGGTCGAGT
CCCCAAATACAATCTACCTCGTCGGCACCTGGGACAGCATCTCGGCGCAC
AACTCGTTCCTTGCCTCCGCCGAGAACCAAAAACTCCTCGCGGATGCGAA
GGACGTGCTCAACGTGGATGCCATGTACCATGCTGAGATGGATGGGAGCG
TGGTTCCGCTGGCGGCACCAGTGGTGGGTGTTGGCAGGCATCATGTTAAG
CGAGGTATGAAGGAGGGGTTTGAGGACTGCTTTGGAAGGGTTAGGGGGGT
GTTGAGGGGGTTTACGGGGGGGTGGGAGGTTGCGGGGGGATGGAGGGTTG
ATGAGGAGGAGGGGAAGGGGGAGTGGTTGTTGTTTACTGGGTGGGAGAGC
GTGGCGCAGCATGAAGAGTTTGGGAGGTCGGAGAAGTTTAAAGAGTATGC
GGAGATTAAGGGGTTTTTGGAGGGGTTTGAGGTTAGGCATGCTGTTAAGT
ATGAGGCTTGAAAGGGTGAGCCGGAAGGTTTGACGTACCAGTATCAGACT
ATTGCTACTGATAGTGGTTGCATACGATATATTTATGATTAGCCAGTCAT
ATCTCGTCATTTTGAGCACCAAGAGAGAAACAGCCATTGCTTATGTTTGT
T

Sequences in the Contig:

SY0AAA22YG21FM1 SY0AAA29YK18FM1 SY0AAA31YM02FM1
SY0AAA31YM02RM1 SY0AAA43YC15FM1 SY0AAA44YC15FM1
SY0AAA49YC03FM1 SY0AAA57YK17FM1 SY0AAA61YA12FM1
SY0AAA7YK09FM1 SY0AAB10YD11FM1 SY0AAB12YL14FM1
SY0AAB13YO11FM1 SY0AAB24YP02FM1 SY0AAB28YO09FM1
SY0AAB30YM01FM1 SY0AAB34YI01FM1 SY0AAB37YP18FM1
SY0AAB50YN16FM1 SY0AAB55YC14FM1 SY0AAB57YI12FM1
SY0AAC24YM10FM1 SY0AAC33YI01FM1 SY0AAD11YC16FM1
SY0AAD11YF18FM1 SY0AAD31YF08FM1 SY0AAD33YK12FM1
SY0AAD48YB13FM1 SY0AAD49YJ01FM1 SY0AAD4YO09FM1
SY0AAD57YK21FM1 SY0AAD7YP24FM1