Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1883
Length(NT) : 615
Best Gene Model Blast : Link to GSTUMT00004975001 E-value : 1e-103
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1883
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCAATTACTTCCTTCAAC
GCATTCGATAAACTCTACAATACCGATAACAAGGGCAAGCACACTCCATC
ATCACCAACATTAATCCCAACCATCATCTCAACCTGCGACGAAGCTGAAA
AGCAAATCACGACCTTCACAATGTACTCCTGTGTAAACCAACCCAGAGGA
TGCCGCGGGCGAGTAAATATCTTCGGTGGACGATGCGATAGTTGTAGGCA
ACTCAATCTCCGGAAGCCTTCAGTTTTCTCGACGCCAAAGCTTTACCGAA
AACCTTCGATAGACCTCTCGTCATTACACTCGACGTTCCCTGAGTACGAG
AGTCGGTAAATCAGGACTTTCGACCACTACTGCTACTATTCCAGCTACTA
CTACTGCGACTATTACCGACTAAACTTTATCCCTCTTTCAATCATCCTTG
GCCGAGAGTGGAATGTGGGGGGGAGAGGGGGGGAGCGGAAGGAAAGGTTT
ATTCATACTCGAACGAAATTCATGACCTCGATCATCTTGTTGCTTCAGCA
TCTGCGAGAATACGGAAAATGCAATCCACTGACGGAATCGGTGGGAGGCT
CCTTCTGTCTGGCTC

Sequences in the Contig:

SY0AAA7YK05FM1 SY0AAA8YF13FM1 SY0AAB27YL17FM1