Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1882
Length(NT) : 924
Best Gene Model Blast : Link to GSTUMT00004191001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG3809 Score: 109 E_value: 5e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1882
TTGGCACCACCTCCGTCATGGCGGATCCCACCTTCGTCACTTACCGGCCC
GCAACCGCATGTCGTTACGCCGCCGCGTGTGCGATCCCCTTCACGACCCG
GCGACGAGATAGACCTCATGGCTAGGGATAACCATAGAGATAGTGGGGTT
TATATGGACTCCTCGGAGGACGAGGATGAGATTCGCCCGGTTATCGCGAG
GAAGATGTGGCACGGGGAGGTGCGATTTGAGGATCAATGGGGGCGTAGGT
TGATTCCTGTCGAGAGGAAGGATGCTTTCCGCTTCGATCTTTGGCCGGTC
GAGGAGGATGTGGATAATGAGGTTGGGGACGGGAGTGGTTGGGTTGGCAG
GTTCCGAGGAATGAGTCGGGAGTAGAGTAGAGTGGAGCTGGTTTTGATAC
ACTGTGATTAGTGGGGGGGTGCATTATTGATGTTTTATGCTTCATCGTTG
AAGTTAGTGTCCGAGGCCGAGTTAGTATATGGGTCTCTTAGTTGTACTGC
GTTCCTTGCGATTTCCCTCTTCTTCTGCTGTTTAATATTTTACTTTGGGT
TGGGATTTTGGCTTTTGATCTTCACCTTTCTCCCTACTCTTATAGCTCAG
CATTATATGGTGTTTTAGTCTTTTTCTTTTCTTTTCTTTTCTTCTTTCTT
TCTTCCTAATCTCGTCTTCATCGCATCTGGGTTATTTCCCCTCCTTTCTT
ACAGGAGGCTTGATTGATTTTATCAGCGGTACTTATTTCTCATGCGGTTA
GTTTTGAAGTGCACACATAAACGGGTGGCGTCTTCCCTTTTTCTATGATA
TTTTTCCATTTTCCATTTCTTCTCATTACCCATACCAGAACCGTTTTTTT
TTTTTTTTTTCATTTCATTCTCCTACGATACGATACTCGAGTCTAGTTAG
CGAAGGGCAAATTGAAAGTGGCGG

Sequences in the Contig:

SY0AAA17YB09FM1 SY0AAA18YH10RM1 SY0AAA7YJ17FM1
SY0AAB21YG16FM1 SY0AAB45YE23FM1 SY0AAB56YM18FM1