Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1880
Length(NT) : 742
Best Gene Model Blast : Link to GSTUMT00003690001 E-value : 1e-176
Numbers of ESTs : 7

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543717.1| Score: 310 E_value: 8e-27
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1880
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCCATTCCTTCTACCTAGCA
CAAACTTTCCTCCCTTTTCACCAAAGCATGTCCGTGACAGATGAAGATAG
TCTACCAACCACGGCGCCCACTGATCGCTTAGCGTGGCGTGATACCCACA
TCTACGCTTCCGACAGTCGTGATACTCTGCTCGGAGGCCTCTGGGCCTCT
GAAGGTATTACCAACGCCAATCTCTATTCCATGTTGGAGATTATCTGTTC
CTTTACCGATACTTTCCATCTATATGACGACCGCAAACAGTTGGTTGGGA
AAGATGGGCAACAGCTTCGACCAGGCAATTACTTTGTTGTCACTAATGGT
TCCGTCAGTGTCACCGATGAAGTCCCGCTAATTTGTGCGGTTTCGTTGCC
CTCTGGGACTCGTGTTGCATCGTTCCGCGATGCTGTGTTCCAGCGAGATC
GGCGATGCATTATAACAGGCAAGCAGGCGATGTATGCTCATGTCGGCAAG
TGGAGGGGGTTCGAAGCGACTCATATATTTCCTTTGGCATTCGAGAGGCA
GTGGAATGATTGTAACCTCAGCCGTTTGATCACCGTTCCCCCCGCCAATG
AGCCCCACGGATCCATCAACTCGGTCCAGAATGGGATCATGCTCACAAGC
ACGATGCACCAGTTCTTTGCTTCCTATGATGTGTCAATTAACCCTGATGT
ATGTAGGGCTAGATATTCAAGGCTTCGTGGCTAATAATTGTA

Sequences in the Contig:

SY0AAA41YD20FM1 SY0AAA7YJ05FM1 SY0AAB1YH11FM1
SY0AAB46YP23FM1 SY0AAB6YM11FM1 SY0AAD33YN19FM1
SY0AAD51YD01FM1