Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig188
Length(NT) : 1202
Best Gene Model Blast : Link to GSTUMT00000567001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: UV excision repair protein (RadW), putative
Accession: ref|XP_001273937.1| Score: 343 E_value: 3e-30
KEGG Definition: UV excision repair protein (RadW), putative
Accession: afm:AFUA_5G06040 Score: 343 E_value: 1e-30
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0011 Score: 288 E_value: 1e-26
PFAM Definition: ubiquitin, Ubiquitin family. This family contains a number of ubiquitin-like proteins: SUMO (smt3 homologue), Nedd8, Elongin B, Rub1, and Parkin. A number of them are thought to carry a distinctive five-residue motif termed the proteasome-interacting motif (PIM), which may have a biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites..
Pfam Number: pfam00240 Score: 179 E_value: 6e-14
Swissprot: O74803|RHP23_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005635 = Cellular component: nuclear envelope
GO:0031593 = Molecular function: polyubiquitin binding
GO:0042177 = Biological process: negative regulation of protein catabolic process
GO:0006289 = Biological process: nucleotide-excision repair
GO:0043161 = Biological process: proteasomal ubiquitin-dependent protein catabolic process
GO:0016567 = Biological process: protein ubiquitination
GO:0051726 = Biological process: regulation of cell cycle

Sequence:
>Contig188
CCTGAGCTGGAGCAGATGGAGTGGGGGGGACGGAACTTTGGGCTGGTGTT
GATGGTGCCTTCACCGGGGTGGAAGCCGAACTAGAACCAGCAGCGGAAGA
CGAGGATGCAGCTTTAGGTTTATTTGATATCATGCAAACCACAAATCCTT
TTTCTTCAATTTTGTAGTCCCCAACGGTTTTGTCATCTTGCAAGATTTTA
CCAGAGTAGATGAGCTTTTGAGCCGCGGCGTCCCATCCCTTCTCTTTGTT
AATCTTTTCCTTCACCTGGGAAATCGTATCGGTAGGTTCAGCATCAATAA
CAAACTTTTGCTGCTTGAGATCCTTAAAAGTAAGCTTCATCGTGATGAGA
AGAAGCCGTTAAAGACGGAATAGCTGAGATATCTGTTGCTACCAGGTCTC
CTGTGGATGTTAGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTT
TGTACAAAGTTGTCCCCCCAATAGGCTGTAGCAGCCAGCAACCAAGAAAG
TTCTCATAATCATACGGGAAAGTACCACCGCTAAACCACGCGTACACCTA
TCACGCCTTCCCTTCCCCACGATCCCCCTACCACCAACCCTCCCCCCTCC
CTCTCACTCACCACCAATAACTATCAATAAGACAACAGCGAAAACAAAAA
TACCAATGGATTTCGCCCCCTACCAATCCGAGTCTCCGGAGGTCTCAAGA
AACTTCACCCGGCCGACTTCCCCACCTGTACGGTCCTCATATTCACCCCT
CCCCACGCCCCAAGTCCCCCCGCCTGTACTGCCAACCCACTCTTCGCCGT
CGGGATGGGGTAGCGGTGGGCTAGGTCGGGAGACGATAAATCAGTTTGAG
ACGAGTTTGCCCATACGGTTGGACTGGGAAGCCGTTATGGCATACGTGCT
ATTGCCGCCTGCTGGTGGTGTGTTGTTGTTGATTTTGGAGCATAAGAGTG
ATTATGTTAGGTTTCATGCGTGGCAGAGTTCGCTTTTGTTTGCCTTCCTG
GTGATCCTACATCTTATCTTTTCGTTCTCGGCGTTCTTGTCGTACTCGCT
GCTAGTGGCGGATTTAGGCTTGGTTGGGTATTTGGGGTTCCATGCCTATG
TTGATGCGGATACTCTTGATAGATGCGAAGTGCCCTTCTTTGGCCCCTTG
GCCAGCTCGATTTTGGATGATGAGTAAGTGTTGCAAGGGGTTTTCGGCGG
TT

Sequences in the Contig:

SY0AAA16YN03FM1 SY0AAB22YH07FM1 SY0AAB29YG14FM1
SY0AAB41YE07FM1 SY0AAB9YH14FM1 SY0AAD24YH17FM1
SY0AAD43YC12FM1