Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1879
Length(NT) : 718
Best Gene Model Blast : Link to GSTUMT00010981001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein NCU07691
Accession: ref|XP_961726.1| Score: 176 E_value: 3e-11
KEGG Definition: hypothetical protein
Accession: ncr:NCU07691.1 Score: 176 E_value: 1e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P53118|ROG1_YEAST
Gene Ontology:
GO:0016298 = Molecular function: lipase activity
GO:0005515 = Molecular function: protein binding
GO:0006629 = Biological process: lipid metabolic process

Sequence:
>Contig1879
TTGGGCCCACAATAACCTCATTGTCCGAAGGATGTTTGCGAACGCCTACG
GGTGGCCGGTCGTCCAACACCTTGTCGAAACCCACTTCGGCGCATCATAC
GCTGCAACTACAGATGATGTCCCCGAAACCAATCAGGATCAGGCGGACGT
TGCCGGAGACGAATACATAGAAGTCGACCCCGCAAGCCCAATTAAGAGGA
ACAATCGCAGCTCTACAGGATCTTCGGCGCAGTGGTCTGACCGAGCATTC
TTAGTTTCAGACGATGAGGACGAGCCCGCCCAGAACGAGGGTATATCTGC
ATTCTTAAGTACACCGACTACAACTACTCGAAGGAACGTGCGGACTCACA
AAACGCCATGTCCAGCAGAAGTTGATAGGGTCGCCGTACTTGCCTCACCC
AGCGAGGAGCCTGGTGGTTTAGGAATTTTGGGTGTTAGTGGAGGAGTTGG
GTTGGCCAGCAGTGGCGCGGTACGAATGCTCAGAGGTACCGTCGAGGAAG
GCGTTGCGGAGAGAGTTGCTAGACTAGGGTTCAATTAGGCAGATTCTGCT
TTTCCTTTCTTTCTTCTTGCGAGGAGTTCTGTTTGTAGAGATCCGGTTTA
TGCTTGTTTGCTGGAGGTATCTCTGTCTGTAGCAGTGGAGATTGTATAAG
TTTTATCCTTGTAATTGCCTTATTTTCTACGTATTTCATGTGACAATATA
TATAGTTGCATTTTCCTA

Sequences in the Contig:

SY0AAA7YJ03FM1 SY0AAB31YH14FM1