Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1878
Length(NT) : 927
Best Gene Model Blast : Link to GSTUMT00009719001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: aspartyl aminopeptidase
Accession: ref|XP_001263609.1| Score: 972 E_value: 1e-103
KEGG Definition: aminopeptidase I zinc metalloprotease (M18) [EC:3.4.11.21]; K01267 aspartyl aminopeptidase
Accession: aor:AO090005001447 Score: 961 E_value: 1e-102
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2596 Score: 913 E_value: 3e-99
PFAM Definition: Peptidase_M18, Aminopeptidase I zinc metalloprotease (M18)..
Pfam Number: pfam02127 Score: 710 E_value: 1e-75
Swissprot: P38821|DNPEP_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0042576 = Molecular function: aspartyl aminopeptidase activity
GO:0042802 = Molecular function: identical protein binding

Sequence:
>Contig1878
TTGGACTTTATTTAGTCTCCTCTCCCCCGCACAAACTTAGCATAAAACAC
ATACAAATTGCTATCGAATTGACTGCCAGCACATCTTCCCGACAAACCAT
GACTTCAAGCTCGAAGAAGTACGCCCTTGATTTTCTATCCTTTGTTAACG
CTTCACCAACCCCTTTCCATGCTGTCGAATCCGCCAAGCAACGGCTTTTG
GGGGCAGGATTTAGTGAAATTCGAGAGCGTGATTCATGGGCAGAAGCAGT
TAAAGCTGGTGGTCGGTACTTCTTGACTCGCAATGGATCCTCTTTGATAG
CCTTTGGCGTTGGGAAGAAGTGGAAGCCCGGGAATGGAATGGCTCTGCTT
GGAGCTCACACGGATTCCCCAGCTTTGCGTGTCAAGCCTGTCTCGAAGAG
GTTTGCAGAGAAGGGTTCTTTTATGCAGGTTGGCGTTGAGACTTATGGAG
GCGGGTTATGGCATACTTGGTTCGATCGTGATCTCTCTGTTGCTGGTCGC
GCTATGGTCCGTCGATCCGATGGATCCATAGTCTCAACGCTCATCAAAAT
CAACAAGCCAATTCTGAGGATACCCACTCTTGCGATTCATCTCGACCGTC
AAGAGACTTTCGCTTTTAACAAGGAAACTCATCTTTTTCCAATTACGGGT
CTTGCCACCGCGGCTCTCAACAAACCCTCATCTTCTACAACCGAGGAACC
CAAAAAGAAAATTGAAGATGGATTCAAACCTCTCATGGCTATGACCGAAC
GTCACCACCCTGCTGTTGTGGACCTCATTGCCGAAGAAGCCGGTGTTTGC
GCAGGCGATGTCCTTGACTTCGAGATGATTTTATACGATGTCCAGGCTAG
TTGCCTAGGCGGCATCAGTGATGAATTTATATTCTCCGCACGTCTCGATA
ATCTCACCATGTCTTACTGTGCAACTG

Sequences in the Contig:

SY0AAA40YC10FM1 SY0AAA60YL18FM1 SY0AAA7YI13FM1
SY0AAB18YF21FM1 SY0AAD59YF06FM1