Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1877
Length(NT) : 1007
Best Gene Model Blast : Link to GSTUMT00008284001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212592.1| Score: 1297 E_value: 1e-141
KEGG Definition: predicted signaling-associated protein (contains a PDZ domain)
Accession: aor:AO090103000320 Score: 1289 E_value: 1e-140
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1421 Score: 861 E_value: 4e-93
PFAM Definition: No Hit Found
Swissprot: Q0CSC0|NM111_ASPTN

Sequence:
>Contig1877
TTGGGGTCAAGATGCTGGTGGAGCGGGGAGGAAAAGCGATGGATATTGAA
CTCGATGTCGGGGATCTTCATGCTATCACCCCCGATCGCTTTCTTACCGT
CTGCGGGGCCTCCTTCCATGATCTATCTTACCAATCCGCTAGGCTTTATG
CCATTCCGGTCCGGGGGGTCTACGTTTGTGAGCCGGCGGGTTCGTTCCGG
TTTGACGGGATGGACAAAGGGTGGATTATTGAGTCCCTTGACAATAAAAA
AACCCCAAATCTTAATGAATTTATAGAAGTAGTGAAGAATATACCAGATC
GGTCTAGAGTTGTCGCAACTTATCGCCACCTGCGTGACCTTCACACCATG
CACACCTCAATTCTCTATATTGACCGTCACTGGACTACCAAAATGAGGAT
GGCTATCCGTAACGATATCGCTGGACTGTGGGACTTTTCGGATATTGCGG
ATCCTAAGCCTCCTGTTCCCCTTGCTCCAAGCTCAGCCCAGTTTATAAGG
TTGGATAATGTGGGTTACCCAGCAGCTAGTGACCTGGTGCGTAGTTTCGT
TCGGATCTCGTGTGTCATGCCAATAAAGTTGGACGGATTTCCTCGAGCGA
GAAAGACTGGGTTTGGTTTAGTCGTGGACGCCGAGAAAGGGTTGGTAGTT
GTGTCCAGAGCTGTAGTGCCCTATGATTTATGTGACATCTCTATCACCGT
TGCCGAGTCAATTGTCGTGGAGGGCAAAGTCCTGTTTTTGCATCCTCTGC
AGAATTATGCAGTTGTGCAGTATGATCCGACGCTAGTGAAGGCACCTGTT
CAATCCGCTAAGCTCAGCGGTGAACATATCACTCAAGGCGCATCGGCAAT
GTTCTTGGGCTTTAACCAAAACCTCAGAGTAGTTGTTGCCAAGACTTCTG
TTACCGATATCACTACCGTTGCGGTTCCTGCCAACAGTTCTGCGCCCCGT
TACCGAGCGATCAATGTTGATGCGATCACAGTCGACACTAGCCTTAGCGG
CCAGTGT

Sequences in the Contig:

SY0AAA7YI03FM1 SY0AAC16YL02FM1 SY0AAC30YG18FM1