Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1876
Length(NT) : 764
Best Gene Model Blast : Link to GSTUMT00002590001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 353 E_value: 9e-32
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 325 E_value: 8e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig1876
TTGGCGGCTGAGGGGGGAGCACGAAGTCAAAAACATTACCGCTGACGTTA
ATCTTGTCATAGGTGAGGGCATTAAGAACCTAGAGCAATATTGGGGGCAA
CTTGGGGGACTGGGATATTTGCGGAATCTCCTCGAATCTTCGGCCGATCG
GACATTCCTTTGGGTTTCCCTTGTTATCGAGGCTCTGAAGCGTTGCACGG
ATGACTCACCTGAGGTGTTTGCTAAAATTGTCTCCACTGCTCCACAAAAC
CTAGTACAATTTTATACCAAGATTCTTGACACTGTCGCAGACCCCGATAA
AGCCAGACGAATCCTAAAAGTAGTGGTAGCAGCTGCGCGGCCTCTTACAC
TTAGGGAAATGAACGTCGCGTTTAGAATCGGGCGGGATCATAAGACAGTT
CACGACCTGCGGGATCTCCCGTTAGGATTCGAAAAGACGGTGAAAAATCT
GTGCGGGCTTTTCGTGCGGATTATCGATTCAAAGATATACCTCGTTCACC
AAACGGCGAGAGAATTCCTTATTAAGGAAACATCAACTGATCAGGGGAAC
TGGCAGTATACCCTATCTCCCATCGATTCTAGCTTTCTACTGGCGGACAT
TTGTATCTCCTATCTTTTGCTGGACGAGTTTGAAAACGACCCATTAGTGG
CGGATATTCACTGCAGCACTGGAAGGAGGGCAGTTGATAATTATCTCCAG
AGATATGCCTTTCTTGATTACGCAGCTAGCCATTGGGCAGACCACTTCCG
AGATTCACAACATC

Sequences in the Contig:

SY0AAA7YH07FM1 SY0AAB37YD23FM1