Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1875
Length(NT) : 1024
Best Gene Model Blast : Link to GSTUMT00002148001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_05047
Accession: ref|XP_001245606.1| Score: 775 E_value: 2e-80
KEGG Definition: DNA mismatch repair protein (Pms1), putative
Accession: afm:AFUA_2G13410 Score: 772 E_value: 2e-80
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1978 Score: 659 E_value: 1e-69
PFAM Definition: HATPase_c, Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase. This family represents the structurally related ATPase domains of histidine kinase, DNA gyrase B and HSP90..
Pfam Number: pfam02518 Score: 114 E_value: 2e-06
Swissprot: P54280|PMS1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0030983 = Molecular function: mismatched DNA binding
GO:0043570 = Biological process: maintenance of DNA repeat elements
GO:0006298 = Biological process: mismatch repair

Sequence:
>Contig1875
TTGGGGGGTATGTAGCTCGGGACGGACTGTGCTTGTACTGTACGTGTAAG
GGATTATTTCCATTCCGCTTACAATACTTGTACAATAGAGGTTGTGTCAC
ACCCTTCTCTCCCCTCCCTTGCCCTCTCTTTCTTTCAAGGGTGGAGGAGA
TGCTCTCACCCCTACTCTCTCCCTCCCTTTCTCTCTTCTAAAATTACGAC
ATCACCGACCTATACTATACATACATACAAACCCCTCCAGCAAAACTCGG
ACCCTCCAAATACAGTATGGCCACAATTAGACCTATTGAAGGCCGCTCGC
CGGTTTTGTGCTTTCGCCTTGGATTGGTTTGTTTTTGATAGGTTCACCAA
ATACAATCTGGACAAGTTATTAGCGAGGGCTTGACCTCTGTTGTTAAAGA
ATTGGTGGAGAATGGATTGGATGCTCATGCTACGTCTATCGAAGTTAGGT
TTAAGAGTAATGGCCTCGATGCAATCGAGGTTATAGATAATGGGGATGGT
ATTTCGCCGGAAAATTATGAGAGTATTGCTCTCAAGCACTGGACTTCCAA
GTTGACCTCGTATGCGGACCTTGATTCCGTCACCACATTCGGCTTTCGAG
GGGAGGCTTTGTCCTCGCTTTGTGCTCTCTCAGACTTGCAGATAGTCACC
GCGACGGCGTCTGAAGCTCCGAAGGGCACAAAGCTCGAGTTTGAAATGTC
CGGGAAACTCAAGTCTCGCTCCGTCACGGCCGCTCAGAAGGGGACTGCTG
TCCTTGTAGAGAATATATTCAAAACGCTCCCGGTTCGCCGGAAGGAGCTG
GAGAGGAATATCAAGAGGGAGTATACGAAGGTCTTAGGCATACTCCAGGC
TTATGCTGGCGTATGTGTTGGGGTCAAGTTCTCGGTGTTCAACCAGCCGG
CGAAGGGGAGGAGAACCCCGGTTTTTGCTACCAAGGGCAATCCTACCGTT
AGGGAGAATGTCTCAAATGTTTTTGGGGCAAAAGCTCTGTCCGCCTTGGT
CCCAATGAATTTGGAGTTTGAAAT

Sequences in the Contig:

SY0AAA33YN09FM1 SY0AAA62YK08FM1 SY0AAA7YG24FM1
SY0AAD10YM15FM1