Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1874
Length(NT) : 988
Best Gene Model Blast : Link to GSTUMT00003422001 E-value : 6e-60
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1874
TTGGGCCTCATCCAATCAGTCCATCACAGAGTCGCCACCTTCGTCAGAAT
GGCCTATTTTTCCTTCCTTTCTGTTGTGCTTCTCCCCCCGAGGGGACCGT
AGCCCTGCCGGTGGCCCTGACGGCGGTGAGGTTCCACCGTCATGTGAACA
TAACATTAACCAACAGTTGCTGAACGAGCCCCCTTCCTTCCTGGCCATCC
GCCCACATCAGGTGCGAATGAGCGGCAGAAGTGGAAAGAGAATCACCGTG
CATCTTTTCCTCCTACCGCTTCGTCGACTCTGAGTCCGGACGCGCGGTTC
GACCCCTCGAGGAGAGAGATGTTCATGATAAGCCCAATGCTACTAGGTGT
CTCGGCAGCCGGAAAATCGCAGCGGGTCCGAAGCAGCTGGCAGCAAGGTG
GTGTCTCAACTACCTGGATCTCATCCACCTAATTTACCGATGCGGCTTTC
GTACCGTGGGTTATGCAGACTCCGCCGGTTGAGGATGGAGGAAGAAATTG
AGGTATCTTGGACACCCTCCAACAGCTCTTTGAAGATACTTTGTTGGCCT
TATCAGCGAATGGGTCCAGGGCTTTCTTGATCATCATTGATATGCCCAAG
CCTCTGGGGCAAGATAATTTTTTCTTCAACTCGAATAGTTTCAAACAATC
TACTCGTATGGGGGTCGCAATAATCCGGGGTCAATAATGGAATTTCTAGG
ACCCTACATTAGAACGGAAATTTAAGCATCCAAAAGAACACAGCCCTTTC
TACCTGAGGGAGTACCATCACATGGTGCATTGTAGGCACAAGCACTGACT
GCACTGGTAGATTTAGCGCAACTACTCGGATCCGAATGATCGTCAGGGTC
CTAGCCATTGGGCCATTCCCAAATGTGTTCCATGTCCGGAGAAGAACCGG
AAAGAACAACCAAAACACACGATGTCGGTGTAATAACGTGCTCGACAAGC
GGGGTGGTTGTGAGGCGCCTAATACAAGGGAAAGCTAG

Sequences in the Contig:

SY0AAA7YG21FM1 SY0AAC17YF13FM1 SY0AAC42YP22FM1
SY0AAC45YI06FM1 SY0AAC55YK24FM3 SY0AAC7YP13FM1
SY0AAD32YB24FM1