Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1873
Length(NT) : 1538
Best Gene Model Blast : Link to GSTUMT00010343001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein SNOG_06870
Accession: ref|XP_001797231.1| Score: 788 E_value: 9e-82
KEGG Definition: ATPase
Accession: sde:Sde_0331 Score: 423 E_value: 9e-40
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3833 Score: 267 E_value: 6e-24
PFAM Definition: UPF0027, Uncharacterized protein family UPF0027..
Pfam Number: pfam01139 Score: 476 E_value: 3e-48
Swissprot: Q9YB37|Y1758_AERPE

Sequence:
>Contig1873
TTGGACACAACACACAGAACAGCCTTAAAATCTCCCATATCCCAACTCTT
GTTACCTCCCTAGAGCTTATCAAATACCCACAAAGACACCACTGCCCTAG
ACAAAATGCCCCACACACGCATACTTGTCAAATTAAATTCGAACCAATCC
ATCAGCGCGCCGTGCCTATTACCTCAAACGCTCAATCCTCGAGCTCAACT
CCTATCATACGCTAAGTCGAAATTCCGTACAAAAGCCACCAGAGTATTTC
TTCCAGGCGGTGAAGAGCTCCTTACACCACAAGCTGTCCAAGAAGTCCTT
GATTTATGCCACGAGCGCCGTACCGTGGGTCCAACCTTTCTCCTCTCCGC
CGGTGAGCCATACGTCGGTGCGCTAGCGCCCCCATCGCCCGCACGTGCTG
AGATAAGAGCATGTGAAGTACATGTGATAGCGGAAGATTCATACATCGAT
CCACAGGCTATCACACAGTTGGAAGCTGCCGCCAAGTTGCCTGGGATGGT
GCGCGCGGTCGGGTTGCCGGATTTACACCCTGGCGGGAAGTTCCCGGTTG
GCGCGGCGTTCGTCTCGGAGCGCTTTATCTACCCATCTTTGGTGGGTAGT
GATATCGGGTGCGGGATGACTCTGTTTCTGACTGGCCTCACTCGGAAAAA
ATTGGAAGACCAAACCGGTATGAGAAGGGTAGCTGAGAGTTTGCGGGGCC
TGGAAACTGCATGGAGGAGCCCTCAGGAGAGGACGGCCTGGCTCGGGAAC
TGCGCTGCTGGCGACGAGTGGGATAGATCAGTTGGAACTATCGGTGGTGG
GAATCACTTTGCCGAGTTTCAGATCGTGGAGGAGGTGGAGGAGGGGCACG
GGTTGTGCTCGGGGATTGTGGTACTATTAATCCACTCTGGGTCCAGACGC
TTTGGGAAACATATCTTGGAGACCTTCACTAAAGACGACAAATCTGTTTC
ACTGGCCTATGGCGATCCGAAAACGGCCGAATATCTAAAGCTCCACACAC
AAGCCTGCAATTGGGCTAGTAAGTCAAGGGATTTAATTGCTCTACGAATC
TTTGAATGTATAGAAGGGAGTCGCTGGGCACTGCCGGAAACCATAGACCT
GGATACCGCAGCGCATTTAAATGCCAGGCTACAGGGAAGGAGGGTCTTGG
ATATCCTACACAATAGCGTAACAGCAACTCTCTGGCCCCCACACGCTGAA
GCGCAATACCAGAAGCCCATGTTCATCCATCGAAAAGGTGCCGCGCCTGC
GCCGCCAGGAACACCCTTCCTTCCACTCCCTGGGAGCCGAGGCACACCAA
CCCTGCTTGTTAAACCACTCTTCTCAGAACTTAACCAAAACGGATTCAAA
AATGGGCTCTCGCTAGCACATGGCGCTGGCAGAATGCTGTCAAGAAACGA
AGCCCGCGGATTATCACGAAAATACAACAACGACGTTAAAGTGCTCACAG
AGATGAAGCCGATGGAGATGAGGGGTGGTGGGAAGGGAAGGGTTGTGACT
AGTGGTTATGTCATTTGTGATGAAAAGGAGTTAGTCTG

Sequences in the Contig:

SY0AAA15YP13FM1 SY0AAA20YA02FM1 SY0AAA7YG09FM1
SY0AAA9YK08FM1 SY0AAB42YN16FM1 SY0AAB54YK01FM1
SY0AAB56YI08FM1 SY0AAB57YK06FM1 SY0AAB61YD18FM1
SY0AAD29YI13FM1