Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1872
Length(NT) : 629
Best Gene Model Blast : Link to GSTUMT00011427001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An08g02190
Accession: ref|XP_001392336.1| Score: 311 E_value: 4e-27
KEGG Definition: hypothetical protein
Accession: ang:An08g02190 Score: 311 E_value: 2e-27
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9UTM0|YIV2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0003700 = Molecular function: transcription factor activity

Sequence:
>Contig1872
TTGGACACCCTTCCCTACACACCACCGAAGCCAACTGCCACAAATTCAAC
ACATCTCAAGCGTCCAAAGTCCATATCCTGATAGGAGAGGGTAGGAGGAA
AAAGGCGTCACGCAGCCTCGATCAATCAGTTAGACACCCTCCTGGTATCG
AACAAACCTTCCTCCAACCATTGTATTTTCCCAAACAAACACAAAATCAT
CGCCATGTCCTCACCACCATCTTCCCTTTCCTCCTTCTCATCGATGGACT
CTCCGCCCCCCACGCTTCCTCGAACGCCCGTGAAGCGTGCGGCTTCGGCC
GCATTCTCTGATCAGCCCGAGACCTCCCCGACCCTCACGCACCACCACAG
CCACCCGAACTTTAGCGACATCTCCTCCGACACCTCTGGATCCGTTCCCG
GGTCGCCCATGGAAGCGGAAGAAATCGAGCACGCGGAGCAGGTCACAATG
TGTAAGTGGGACAGCTGCGACATGGATATGGGCAACATGGACGACTTGGT
GAAGCACATTCACGACGAGCACATCGGCCTTAGACGGGCAAAGTATGCGT
GTGAGTGGGATGACTGCAACAGAAAAGGAATGGCGCACGCGAGTGGTTAT
GCGCTCAGAGCCCATATGAGAAGTCATAC

Sequences in the Contig:

SY0AAA7YF08FM1 SY0AAD44YM03FM1