Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1871
Length(NT) : 1493
Best Gene Model Blast : Link to GSTUMT00000554001 E-value : 0.0
Numbers of ESTs : 23

Blast Results:

Nr Definition: hypothetical protein SNOG_13577
Accession: ref|XP_001803784.1| Score: 626 E_value: 5e-63
KEGG Definition: hypothetical protein [EC:6.3.2.19]; K09561 STIP1 homology and U-box containing protein 1
Accession: mgr:MGG_08035 Score: 579 E_value: 7e-58
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4642 Score: 473 E_value: 7e-48
PFAM Definition: U-box, U-box domain. This domain is related to the Ring finger pfam00097 but lacks the zinc binding residues..
Pfam Number: pfam04564 Score: 235 E_value: 3e-20
Swissprot: Q9UNE7|STUB1_HUMAN
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0031371 = Cellular component: ubiquitin conjugating enzyme complex
GO:0030544 = Molecular function: Hsp70 protein binding
GO:0030191 = Molecular function: Hsp70/Hsc70 protein inhibitor activity
GO:0051879 = Molecular function: Hsp90 protein binding
GO:0030674 = Molecular function: protein binding, bridging
GO:0046332 = Molecular function: SMAD binding
GO:0030911 = Molecular function: TPR domain binding
GO:0004842 = Molecular function: ubiquitin-protein ligase activity
GO:0032436 = Biological process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process
GO:0031398 = Biological process: positive regulation of protein ubiquitination
GO:0006457 = Biological process: protein folding
GO:0051604 = Biological process: protein maturation
GO:0000209 = Biological process: protein polyubiquitination
GO:0031943 = Biological process: regulation of glucocorticoid metabolic process
GO:0030579 = Biological process: ubiquitin-dependent SMAD protein catabolic process

Sequence:
>Contig1871
TTGGAACTCGCCAAATTTGCATTCTGGCGACAACGGGCACGAAGGGTCTG
TACTTGTGAGTACTCGTACATAGTACCCGTTCGAGTCCTTAGCTCCCTCG
CGCGTGTCGTCTCTCTTCTCTTCTCTCACTCAACCCTCTAGCTCCTTCGC
TTTCCACTCACAACCTTAACACTCTCTTCTCCTTCGCACGATATCATACA
CACACGACTACGGCATACATATCGCAGCGCAGCGCGGCCTCCCTATCAAA
CCATCATCCCTGCGTATTTCCTCCCGACGGCGCCTCCCCCGGATTTTTCT
CCTTTGAGCCTCACTCACGAGTCGAGCTGCTGCGCCCCACTGGAATCTCA
ACATCTAACTTATTGCCTCCCTAACACAAATACCATCCGCACCTTTCCCC
ATTTCTCTATCTCTCGAAGATCGACATTTGTGTCGGTTTCGTTTCCCGAT
ACGCTCAAAAATTCCAAATTCTCGACAAAGTTCCTTACCTAGACCAGATG
CCTATGAAGGCCGAAGAACTGAAAAATAAGGGGAACGTGTGCTATGCCGA
GGGGGATTATGTCGGTGCGGAGAAATTTTATACTCAAGCAATTATAAAAG
ACTCTACGAATGCCGCTTTCTTCACTAATCGTGCGCTAGTAAGATTGCGC
ATGGACATGTACGATCAAGTCATAGACGATTGCTTGAAGGCTATTGATCT
CATCCCATCTTCACTGAAAGCATATTCATACCTCGGACAAGCGCAGCTCA
AACTTGGCTATCCGAATGAGGCTCTATCATCCACCCTCCGCGCATACGAG
TTGGCCATTGCGCAACGCTCTCCTAGCGTTGGTGCTATCGCAGCGACATG
TCTTGAAGTCAAGAAGAAGCGCTGGGAACTCTCGGAAGAGCGGCGTCGTA
CTCGCGAATGCAACCTGTTGAAGCAGATGACGCAGATAATTGAGCGCGAT
GCGGAACGCGAGGTTGATCTTATTCTTCGTTCCCCTACCTGGGACCCTGT
CAGTAGTGGGAGGGATTACTCCGAAAGCGAGACGCATGAGAAGATTGACG
ATGTTAGGAGTGCTTCCAGGGAGAAGATTCAGACTCTTGAGGAGGTGTTT
GGAAAAGCCGAGGCGGAGAGATGTGGAAAGAGAGAGGTTCCGGATTACTT
GATTGATAACATCACCTTCAGTGTTATGCTGGACCCCGTCATCACCAAAT
ACGGCCATTCTTATGACCGCGTAACACTGCTTGATCACCTTAAGCGTTCT
TCCACCGACCCTCTCACAAGAGAGCCGCTAACTGAAAAAGACTTGAGACC
AAATCTAGCCCTTAAGGCCGCCTGCGAAGCATTCCTCAAGGAAAATGGCT
GGGCAGTCGATTGGTAGATTTGTGAAGTACCGGTACAGCACCGAAAAAAC
AGGGGACAATTCCAGTCCCAATTATCTTGTCAGGTTTTGCTTCTTAATTT
CACACTATTCTCACTCGTACTTGTACCCCTCCATTATCCCTCT

Sequences in the Contig:

SY0AAA27YO01FM1 SY0AAA35YB16FM1 SY0AAA42YL08FM1
SY0AAA6YD16FM1 SY0AAA7YD12FM1 SY0AAA8YD12FM1
SY0AAB10YF22FM1 SY0AAB1YB17FM1 SY0AAB32YD16FM1
SY0AAB39YN06FM1 SY0AAB45YD03FM1 SY0AAB49YE10FM1
SY0AAC11YO22FM1 SY0AAC28YD06FM1 SY0AAC35YG01FM1
SY0AAC41YJ06FM1 SY0AAC41YK05FM1 SY0AAD12YL01FM1
SY0AAD1YP16FM1 SY0AAD25YO21FM1 SY0AAD56YP17FM1
SY0AAD57YK05FM1 SY0AAD7YK16FM1