Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1870
Length(NT) : 1247
Best Gene Model Blast : Link to GSTUMT00003482001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001541342.1| Score: 432 E_value: 1e-40
KEGG Definition: hypothetical protein
Accession: ang:An08g02780 Score: 409 E_value: 3e-38
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4673 Score: 205 E_value: 7e-17
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 193 E_value: 2e-15
Swissprot: Q6CDX0|SMI1_YARLI

Sequence:
>Contig1870
TTGGGTGTGTGTCAGGATGAATTTCCTACAGAAGGGGCTTGCCGGATTGG
AGAGTCGGCTGGATAAGGTGTTGTTGGATGAGCCCGGGGGACAAACGAGT
ACTACGCCGCCGCCGCCGCCGCCGCCGACGTTGCAGCAGACGAAAGCGGA
GGAGAAAGCCGCAAATACTGTTGCTGTGAAAGCTGGGAGAATAAGTCTAC
AGGAGCGGTTAGCAGCCGCGACAGCTCGGAAGGAGCGGGATAGGAGTCGG
AGTCCCGGGATCGAAGATGGGGAGCCGGTCGATAATGAAGAAGGCGAGCA
TCGACCACCTATAGCAGCGCTAGGGGAGTCGCCCGCACGTCCATCTACGG
ACTCCACCGCATTGAAACCCACAACCGACCCGCCACCAGCTCCCCCGCCT
CCCCCGGAAATAATCATATCCCCGCGCGGATCACTAGAAACGAACGGCCA
CACCGATGTTTCCCGCGAAGACCTAGAAACCACAATCAGGCTCCTCCGCG
AGGACCTAGCGCTATGCGAGGCCCGGCGACAGGAGGAATCACACACCGCG
GCGGAGCGCATTGATGCACTGGAGGACAAGATCCGCTACCTTGCGCGCGA
GTCTGCCGAGGCGGCCAGGCAGAAAGCCAATAGTGCCCCATCAGGATTGG
AAAAGAAGCTCGCGGAAGCCCAAGAGAAGATTGCGCTTCTGCTGGAAGAA
GGGGAGAAGCTGAGCAAAAATGAACTGAAGCTGCAGAATTCAATTAAAAA
GTTCCGCGCCAAGACACAGGAGGAGGAGAAGGCTACCGCGGAGGCTAAGA
AGCGCGCGGAGAGGGCAGAGAAGGAGGCTGTTGACGCCAAAGAGAAAGCT
AAGCGTGCTGTGGAGAATGAGAAGAGGGCTTCTGAGAGGGCTAAAGGGGC
TGTGAGACTTGAGAGTGAGGTGGAAAACCTCAGGAGAGAGAAGGAAAGTT
CTGCAAAAGTCATTGCTGAGCTTAAGGGTAAACTTGAGGAGGTTAGGGAT
AGGGCGGAGGATGCGGAGAGCAGAGCCCAGGCCGAGATGCTTGAGAAAGA
ACGGAGGGTCACGGTTGAATTAAAGGCTGAGGTTGAGAGGGTTCAAAGTG
AAGCTACGCTAGCTGAGGAGAGACTACAAAGCGAAGTCCAAGATTTGAAG
GCCAAGATTGAGAGGGACGCCGAGAGGGCGAGGATAATGGAGGAGGAGTT
GAAGGGAGAGCAGTCTGTGCGTTGTCATATGACTCGAGTGATTGTGA

Sequences in the Contig:

SY0AAA7YB17FM1 SY0AAC55YH24FM2 SY0AAD35YK10FM1