Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig187
Length(NT) : 1262
Best Gene Model Blast : Link to GSTUMT00003624001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_05729
Accession: ref|XP_001592808.1| Score: 1189 E_value: 1e-161
KEGG Definition: vacuolar protein sorting-associated protein
Accession: aor:AO090003001064 Score: 1137 E_value: 1e-151
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1796 Score: 116 E_value: 1e-06
PFAM Definition: DUF1162, Protein of unknown function (DUF1162). This family represents a conserved region within several hypothetical eukaryotic proteins. Family members might be vacuolar protein sorting related-proteins..
Pfam Number: pfam06650 Score: 298 E_value: 1e-27
Swissprot: Q07878|VPS13_YEAST
Gene Ontology:
GO:0019898 = Cellular component: extrinsic to membrane
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0045324 = Biological process: late endosome to vacuole transport
GO:0045053 = Biological process: protein retention in Golgi
GO:0030437 = Biological process: ascospore formation
GO:0007039 = Biological process: vacuolar protein catabolic process

Sequence:
>Contig187
TTGGGGCAGTTAAGCTCGAAGATGGGGAACAAGTGCCTTGGAGATTCGAA
GAATGGGAGAAGATGCGGGAAAACTTGAGCCCCGATGGATCTAGTGGCAT
TGTAGGCATCAAAATCGAAAATTCAGGGTTCGAGAGCATAACCGAAATAC
CCGTTAATAAGGAAGGCGAGACGCTCTACACACTTCGTCCGCCAAAGGAT
AATACCCTCCACCGTCTACTATGTGAGGTACATCTTGGGACAGATAACGT
CAAAGATCGGTGTCTTAGACGTCGAAGCTCAGCATATTGTCAGAGTTTAT
AAAATACTACCGGGTGAAAGCCAGCCAGCTCCAATAGAGACCGCATATCA
CCAATCAGTAGTGGTTAGACCAGATGCTGGGTTCGGGTATAATTGGTCTC
AAGACCATCTGTTCTGGAGGACCCTTTTGAAAAAGCCGACCAAATGTCTC
AACTGCAATAGCGAGGAAGGAAATAATGCGCCCCCATTTTACTTCCAAAT
GCATGCCACCTTCTCACGGAATAACCCAGTCGCGAAATTATATCCGTACA
TGAGGATCCAGTTATCTGCACCCCTCGAGGTTCAAAACCTTCTTCCTTAT
GACTTCAAATTCCGCATATATGACAAGCATACCAAGAAAGAATGGACGAA
TTTTCTTCGCAAAGGCGGCTTGAGCCCAGTCCATGTGATCGAACTTTCAC
ATCTACTTCTCATGAGTATCGATATGCAAGATACCGTTTATAGCGCCAGC
GACTTCGCTATAATCAATTCCGATAGCACAGAGTTTGATAAAGAAACAAC
GCTGGTGGCGAAAGACAACCAGGGCTTGGAACTAAGGCTTCGGCTACATT
ACTTCCCGATTGCTAACAGTGGTGGCGCCTTCCGAGTCGCAGTCTATAGT
CCTTACGTGATTCTGAACAAAACTGGGTTGACGATGATGGTTAAGTCTAA
GTCTCTGTTACAATCCGCAAAGGTCGCCGCAGGGCAGATGCAAACGAGAT
CCTCTCAACGAGCTGTCCCCTACATGTTTTCCTACCCGAATGATGACCGG
CAGAACCGTGCGGTTCTCAAAGTAGGAGATTCGATCTGGAGTAGACCTCA
CAGCTTTGAAGCGATCGGGAACGTTGCAGACGTAGTCCTCCCGTCCTCAA
CAAAGGAAACCGAGTTGCATATCGGAATATCAGTGGACGAAGGAGAAGGA
AAATACAAAATGACGAAAATCGTTACTTTGACTCCTCGATTCATCCTTAA
GAGCAAATTATC

Sequences in the Contig:

SY0AAA16YM11FM1 SY0AAA35YM09FM1 SY0AAC52YM01FM1