Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1868
Length(NT) : 1053
Best Gene Model Blast : Link to GSTUMT00007270001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543717.1| Score: 318 E_value: 3e-50
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1868
TTGGCAAAACATTCCATTCTCTTTTTTTTCTTTTCCGTAAATCCAAACAT
GTCGTCTGCTGATCGTTCCGCATGGCGCAATACTTTCATTTACACTTCCA
ACGATCGTGATACCGTGCTCGGAGGCCTCTGGGCCACACCAGGTATTACA
AACCGCAATCTCTATGCCATGCTGGAGATTTTCTGTTTGTTTCGCGACAC
TTTCGAGCTACACGACAAGGACGGACAGTTGGTTGAAAAGGATGAAGCAC
AGCTTCAACCGGGCAATTACTATATTGTCACTCAGGGTACTATTATTCTC
ACTAACGAGGTACCGCTACTTCGTACGATTTCGTTGCAGTCCGGAACCCG
TGTTGCCGCGTTCCGTGATGAAGTACGTGCGCGAGACGGACGCTGCATTT
TAAGCGGTCACCGACCAGCGCCGGGCAGGTGGATAGGCTTGGAAGCCGCT
CACATATTTCCCCTGGCATACGAGGGGTACTGGAACGATCGCAACTACGA
CCGTTGGATTACCATTCCGCCCGCCAATGATTCTCACGGATTGATCAACT
CTGTACAGAATGGGATCTTGCTCAAGAGTGATATGCATCATTTTTTGATT
CCTATCATTTGACAATTGATCCCGATGATAACTACAAGGTCGTCTCCTTC
GCAGAGGAATCCCTTCAATTTAACCTACCTCACCAACTTGATCAGACGTT
CCTCGATAATCCACTCCGACCGGTCGATCAGCTTCTCCGCTGGCATTTTC
GCCAGGCAGTGCTCACGAATATGAAGGGAGCTGGGGAGCCTTGTTTTGAG
AACGATTTCCCGCCTGGCATGGACATGATGGGTGAGATCATAAGCGGTCC
AAAGGCTGGAGAGAGGATGGAGTTTGAGCTGTTTAGCCGCTTTAATGCAG
CGGAGGGTTCACACGTGGTGAAGTCTACGAGCACTACTAGCACAATATTC
AATAAAACTGGGTTTACCAGCGGTGTTCGCTCATAAATTCACCAGAAACC
AAGCGAGCCCGGAGGTGTGATGTTAAACAAGACGAGGAACCAAAACACTT
CGT

Sequences in the Contig:

SY0AAA7YB03FM1 SY0AAB15YE20FM1 SY0AAC35YO20FM1