Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1866
Length(NT) : 812
Best Gene Model Blast : Link to GSTUMT00006433001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0229 Score: 109 E_value: 6e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1866
TTGGCATACAATGGGAATGGTAAAGCGGGAATCCTCTCCGACCACCGCAG
CAGGGCCGCCCACGACAACTACTTGTAAAACTAAATGATGGTGTACTCGT
ATCATACTCGATCTTTGTTTCACCGTGCTAAAATGGTCTTCCTTCTTATC
CACGCCTTTCTCCTAATCTCCTTGGATCCTCCAGCCTCTTCTTCCGTTCT
CCGAGTTTCTACCTTTCTAGCGGGCGGATAACACCGATAAAAAACGACCC
CAACTGTTTCCGGCGAAAAAAGTCAGCGTTAACTGGTCCACGAAGAAAAA
ACTGTTTGCCCTATCATGGCGGATCATTCGAAACCGAACTCTTCTGGGAG
AGAGCGTGGGGGACCGCAGTCATATGATTGGGCCCACATGTCGAATAGAG
GATTTTTCGCCCGTCTCGTGCTTTCGTTCTTCTCGACAAAATACGGGATA
GATATGACGATACATTGCCTTTTGGAGCCGTTTCGATATTCGCTAGCTTC
GGCGGACGAGCTGCAAATTCAGGCCGAAGAAACGGATTATCTATTTGGCC
TTCCGCATAACAGCCAATGGAGATCTCCGGAAATGAAATGGCATTTCAAT
CTTGAGACTTTCTTCTCCTTATATTATGCCTACTTCCATAGAGCAGCACC
CCTCCTGTTCTATCATCTTCGCAAAGACGCCTTCAAGCTGGACGAAGAGT
ATTACCAAAGCCAGTTCACAAAGAAACTCCGCCCAGTAGATGGCCTGGGT
TTTAGTGGTTCTCTGTTCTTCTATTCGGATGATAAAAGTTTTATCGTGAA
GTCTATTGGCCG

Sequences in the Contig:

SY0AAA7YA08FM1 SY0AAB9YC24FM1