Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1865
Length(NT) : 1004
Best Gene Model Blast : Link to GSTUMT00004293001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: translation regulator GCD7
Accession: ref|XP_001264820.1| Score: 283 E_value: 2e-23
KEGG Definition: translation initiation factor 2B, beta subunit (eIF-2Bbeta/GCD7); K03754 translation initiation factor eIF-2B beta subunit
Accession: aor:AO090012000928 Score: 275 E_value: 8e-23
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1465 Score: 284 E_value: 3e-26
PFAM Definition: No Hit Found
Swissprot: P32502|EI2BB_YEAST
Gene Ontology:
GO:0005851 = Cellular component: eukaryotic translation initiation factor 2B complex
GO:0032045 = Cellular component: guanyl-nucleotide exchange factor complex
GO:0005739 = Cellular component: mitochondrion
GO:0030234 = Molecular function: enzyme regulator activity
GO:0005515 = Molecular function: protein binding
GO:0003743 = Molecular function: translation initiation factor activity
GO:0006446 = Biological process: regulation of translational initiation

Sequence:
>Contig1865
TTGGTCCTAAATACCTTTTCTCTGCGTCAACCGACCCCTATTCTGATTCT
ACAGATAGTAAGAAATTACGCTTGCTTCGTTTCGGTTAGAAGGATATCTC
GCGATCTACACGCAGGACCTTAGTTGGTGAAGATCTCTCAAAATGGCCTC
CCAAATGGTCACTCTCAGAACACCTGACCTTCAATGGTGGCTCGATCACC
TCGACACAGCATTTGCTCCCGATGTCTCGGTTGATCTATTTGTTGGTGTT
CTCAAGCGTCGTAGCGTTAAGGGTCCCGAAGCCGCAGCAATAGCAACGGC
TCAACTTTTTCTTCGTTTGATCTACGCCCACCCGTTTTCTAGCATAGGCG
ATCTTGTGGATCATATCTCTTCGATTGGGACTAAGCTTTCAAAAGCTGTC
CCCCGCGAGTTAGCTGTTAGAAACATGGCTCGAAGGGTGATTGGTATTAT
TCGTGAGGAGGCCGAGAATAATGGCATGGGAGATCTTTTTCAGGCTGCAC
TGGAGATAGAGGAACCCCTCCAGGTTTCTCGTGCTCCTATAAAGAGTGCC
GATACTAGAGCTCAGCTTGCTGGGCATGGCTCATTTGCGAGTCCATCGAG
CTCTGTGACTGGAGTTTTCGAGATTCTCTCTGTTGCTTCTTCGTCTCGCG
GGTCGTCCGCAGCTTCAACACCCCCGTCCACCAGCATGGGGATGGCGCCG
CAGGCACAAGCCGTCCAATATGATATTCGCCCGGCTGTGATACAGGATAT
CCAGGAGCTCCTTGAGGAGCTTGATTCTTGTGAACATAACATTTCTGAAC
TTGCAACGCAGGTAATCTACAAGAACGAAGTGATTTTGACTTATGGGCTT
CCACCACCTGTTCATAAACTTCTCCTTCGTGCTGCGCAAAAGAGAGAGTT
CACATTGATTGTAGTTGTGGATGAGATAGCCGGTATCAATAAGCAGGCCA
GCGCTGCTGTTATGAACAATCCGGTGGGTAGGGAGGAGACCGGGGGTGAC
CAGG

Sequences in the Contig:

SY0AAA50YN23FM1 SY0AAA6YP22FM1 SY0AAB30YK13FM1
SY0AAC16YK13FM1 SY0AAC21YK11FM1 SY0AAC5YM08FM1