Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1864
Length(NT) : 1653
Best Gene Model Blast : Link to GSTUMT00010984001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein FG05323.1
Accession: ref|XP_385499.1| Score: 928 E_value: 6e-98
KEGG Definition: hypothetical protein
Accession: fgr:FG05323.1 Score: 928 E_value: 3e-98
KOG Definition:
Classification: [Nucleotide transport and metabolism, Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG3968 Score: 878 E_value: 7e-95
PFAM Definition: Amidohydro_1, Amidohydrolase family. This family of enzymes are a a large metal dependent hydrolase superfamily. The family includes Adenine deaminase EC:3.5.4.2 that hydrolyses adenine to form hypoxanthine and ammonia. Adenine deaminases reaction is important for adenine utilisation as a purine and also as a nitrogen source. This family also includes dihydroorotase and N-acetylglucosamine-6-phosphate deacetylases, EC:3.5.1.25 These enzymes catalyse the reaction N-acetyl-D-glucosamine 6-phosphate + H2O <=> D-glucosamine 6-phosphate + acetate. This family includes the catalytic domain of urease alpha subunit. Dihydroorotases (EC:3.5.2.3) are also included..
Pfam Number: pfam01979 Score: 243 E_value: 4e-21
Swissprot: O14057|GUAD_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1864
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTTCGAGATAGGCGACCAA
CCCCGAGCTCTTATCACTTGAGTGCAGTAGGAAAAAATTACTCCATCTGT
CATATGAGAGCCTCCGGCCCCCACCTTCCAACTACTCGAGTACTTATACT
CCCCCTTCCTCCCCCTTGCCTTCACCACTCTTGTCTTCTCCCCCACCACC
ACCTCTCACGATGGCGTCAACATACTACCTCGGGACCTTCATCCAGAGTC
GCTCCCAAACCAACCTCGAAATCGTCAAACATGGCACAATCCACGTCTCC
GACGGAATAATCCGATCAATCCATCGAGTGGGAGAGGACTATAGCGAGTC
AGACAGCCTCCTCCCTCCATCACAGCTCCTAAGAATGCTCGGCTACGACA
TCACCGAACCACTCACAATTTGGGAAATTCCAGAGAACCACTTCCTCTTC
CCGGGCTTGATAGACACACACATACACGCAAGCCAGTACCCAAACCTGGG
CTTATTCGGCAAGACGACACTCCTGGAATGGCTAAACAAGTACACATACC
CGCTCGAATCCAGCCTAACCGATCCGGTGAGAGCGAAACGTGTGTATACA
CAATGCGTGAACCGCTCATTGCAGAATGGGACCACCACGGCAGCGTACTA
CGCAACGCAGAGCGCGCGGTCGACGAATATCCTGACGGACGTGCTCATTA
ACCTCGGTCAGCGGGGCTTCGTAGGACGCTGTGCGATGGATTCAGACCTA
CAACCGGAATCGTACCGCGACGAGAGCCCCAAGGCTGCGGTCCATGATAC
AAAGGTGTGCGTAGCGTACTGCAAAGAAGCAGACAAGAGTGGCAGAGTGC
GCGGCATCATCACACCACGCTTCGCACCGAGTTGTTCGCGCGATGCACTC
CGAGGCCTCGGCCGCTTACTCGCGGACGGTGAGAAGGATGGCCTCCTCTG
CCAGACCCACATCTCGGAGAACAAGCGCGAGGTGGCACTCGTAAAAGGGT
TATTCCCGGAGTGCAGTAGTTACGCCGAGGTCTACGATACGTATAACTTA
CTCACCCCCAGGACTGTGCTCGCGCACGGCGTTCACTTGACTGAAGAAGA
GGTCGAGCTCATCAAGAGTAAAGGGAGTGGGGTTTCGCACTGTCCGACGA
GTAACATGGCGCTGGGGAGTGGGAATATGTGGGTTAGGCGCTTGCTCGAC
AAGGGTGTTAAAGTAGGCCTTGGAACGGATGTTTCCGGCGGGCACGACGT
GAATGTTCTTGAGGCGGCGAGGATGGCGTGTTTTGCTTCGCGGAGTGTGG
CGGAGGGTGGGAAGGGTGAGAGGAGCAAGATTTCGGTAGAGGAGGCGCTG
TGGCTTGCGACGAGGGGTGGTGCGGAGGTATTAGGATTGAAAGGAAAGGT
GGGAGGTCTGGAGGTGGGCATGGTTTGGGATGCTATCCTCGTCGGCCTTA
ATGGGGTCCCCTTCAATCTGTGCGGGGAGGGGGACGTCAATGGGGCACCA
AATGGAATCCATCACGGAGGGAAAGGGGCCAAAATCGGCGGCAAAGTGGA
CATTTTTGGGTGGGAGAATTGGGAGGAGAAAGTCGCCAAGTGGCTATACT
CGGGCGATGATAGGAATATCAGGGCGGTGTGGGTTGGCGGGAAGTTGGTC
CAA

Sequences in the Contig:

SY0AAA44YM18FM1 SY0AAA47YM04FM1 SY0AAA49YI10FM1
SY0AAA6YO16FM1 SY0AAB17YI19FM1 SY0AAB31YC08FM1
SY0AAC27YK12FM1 SY0AAC28YK13FM1 SY0AAD13YC10FM1
SY0AAD15YM03FM1 SY0AAD16YB10FM1 SY0AAD51YO18FM1
SY0AAD55YG12FM1