Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1862
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00001907001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An01g00070
Accession: ref|XP_001388459.1| Score: 163 E_value: 6e-10
KEGG Definition: hypothetical protein
Accession: ang:An01g00070 Score: 163 E_value: 3e-10
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1253 Score: 116 E_value: 6e-07
PFAM Definition: TRM, N2,N2-dimethylguanosine tRNA methyltransferase. This enzyme EC:2.1.1.32 used S-AdoMet to methylate tRNA. The TRM1 gene of Saccharomyces cerevisiae is necessary for the N2,N2-dimethylguanosine modification of both mitochondrial and cytoplasmic tRNAs. The enzyme is found in both eukaryotes and archaebacteria.
Pfam Number: pfam02005 Score: 105 E_value: 9e-06

Sequence:
>Contig1862
TTGGATTACGTCCACACTCCCATTCTCTCAATCTACGTGTCCTGAGCCCA
ACAGGGTTCGCAAAAATCCATTCCCGGGCATTCTCTAAATACTCTACGCT
GCTTAATTCCGACCACCACAGTCAAAAACTGCCCAGCCATCCCCAAACAC
CCGCACCTGCTGCAACCACGAGAATGGGTAAAAGGAAACGAACGCCCAAC
CAAGGACCCATTGCCCCGAACCCAGCCCCCGCACATGCATTCCCGGTAAC
GCTAGAAGATGGCACTGAGTGCACTGCGGTGAGGGAGGGTCTGGCGACGG
TGCTGTTTCCGAGGTTTGTCGCTAAGAAGGATAAGAGTGGGAATGATTTG
GTGGACGGGCAGGTATTCTATAACCCAGTTCAGCAATTTAATCGAGATTT
GAGTGTTTTGGCCATCCGAGCTTTCGGGGAAGTTTTTTTGAGGGAGAAGA
AAGCGAAAAAGGCGGCCAAGATGAAGGGGGATGAGGATGTGGGGGGGAAG
GAGAGCGAGGTTGCGGCTAGGGACAGGACACGGGAAGGGGCCGGGGGGAT
GGGGGTAGTTCCCGAGACAAAACAGGATCAAAGGAAGGAGGGTAGAGATA
CAGTGCAGGAGAGACCAATGAAAGCGGA

Sequences in the Contig:

SY0AAA6YO13FM1 SY0AAB20YG10FM1