Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig186
Length(NT) : 593
Best Gene Model Blast : Link to GSTUMT00006784001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001208443.1| Score: 200 E_value: 3e-14
KEGG Definition: hypothetical protein
Accession: ani:AN5553.2 Score: 189 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P38364|PID6_FUSSO

Sequence:
>Contig186
TTGGCCTTTTCTCTCCACCTCCAACCATCCTTGCCTAACTAACTACTTCC
TTACTCCCCTAAGCTTTCATAACAGCGTAGTCCCAAAATCCAGGTCACCG
GTACCCAGTTAAACAGCCTAGCGAGTCGGCCAAACCTTCTCATTAGTATA
GTCACGATGCCTTCATTGCTGCTGATGTCCCTGGCACCGTCACTCAAAAC
ATTGGTTGTATTGGAGTTCACTCAGGTGCTGCCTCTCGCGCTGCTGGCAC
TCGTGGCAAGTTGTGCCTACTCGCGGTATGCGAGCCCGCTCAAGAATGTG
CCCGGTCCAGCGCTTGCCAGCTTTTCGAGAATATGGTTGAATGTGGGACT
GGTTGCTCGTGGCAATTTGCATGGGGGGATAATGGACGCGCACCGCAAGT
ATGGTCCTGTTGTTAGGGTCGGGCCAAACAAGGTTTACTTTTCGGACCCA
GCGCTAATTCCGGAGATTTATGGTGTCGGGACGGGGTATCGCAAGAGCGA
TCTTTACATGATGTCCGATCCGGAGCCTGGGCATGGCAGTACTTTCAGTG
AGCGATCTGCCGAAAAGCACGCGGTGCTAAGAAGACGAGTTGG

Sequences in the Contig:

SY0AAA16YL20FM1 SY0AAA53YE24FM1