Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1859
Length(NT) : 769
Best Gene Model Blast : Link to GSTUMT00001713001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_08043
Accession: ref|XP_001240880.1| Score: 768 E_value: 7e-80
KEGG Definition: hypothetical protein
Accession: ang:An03g02890 Score: 766 E_value: 6e-80
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG2520 Score: 573 E_value: 8e-60
PFAM Definition: XPG_I, XPG I-region..
Pfam Number: pfam00867 Score: 184 E_value: 9e-15
Swissprot: P28706|RAD13_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0006295 = Biological process: nucleotide-excision repair, DNA incision, 3'-to lesion

Sequence:
>Contig1859
TTGGAGAAGAGTAAGCGGATGGAGAAGGCTATGTTACAGATGATTCGGAT
ACGTTCTTATTCGGCGGGACGAGAGTGTACAAGAACATGTTCAATCAAGC
CAAATTCGTTGAATGCTATCTCGCCGGCGATTTGGAGAAGGAATACGCAC
TCGACCGGACAGGGCTTATTCGGATAGCGCATCTACTCGGCAGTGATTAC
ACAGAAGGCGTGCCCACCGTTGGTCCCGTCACAGCCATGGAGCTCCTAGC
CGAATTCGCGAGCGATAATGGCCTAACCGAATTCAAAGAGTGGTGGACAG
CAGTACAAACCGGCTTGAGAAAGCCTGCGGACGACGACGATAACCCCTTC
CGGAAGAAATTCCGCAAAAACGCCACAAAAGTCTTCCTCCCAACAAACTT
CCCAGACCCACGTGTCGACGAAGCCTATATGCATCCAGAAGTCGACCACG
ACCCCTCCCAGTTCGAATGGGGAATGCCAGACCTCGATGGTCTCCGGCGC
TTTCTCATGGCGACGGTAGGCTGGTCGCAGGAGCGCACTGATGAAGTACT
TGTTCCGGTCATCAAGGACATGAATACGAAGCAAGTTGAGGGTGCGCAGA
GTACTATTACACAGTTTTTTGAGGGTAGGATGGGGACGGGTGCGGCTGGG
ATGGCGGGCGCGCCGAGGAGGAAAGTTAAGAAGAGTAAGCGGATGGAGAA
GGCTATGTTAAGTTTACACGAGAGGGCCAAGAGGATTAATGGCAGTGGGG
GGGGCACAGCGGGCGAGCA

Sequences in the Contig:

SY0AAA6YN13FM1 SY0AAD60YC18FM1