Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1858
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00001645001 E-value : 1e-157
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_09005
Accession: ref|XP_001552823.1| Score: 595 E_value: 5e-60
KEGG Definition: hypothetical protein
Accession: fgr:FG01686.1 Score: 548 E_value: 7e-55
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0023 Score: 552 E_value: 1e-57
PFAM Definition: ADH_N, Alcohol dehydrogenase GroES-like domain. This is the catalytic domain of alcohol dehydrogenases. Many of them contain an inserted zinc binding domain. This domain has a GroES-like structure..
Pfam Number: pfam08240 Score: 286 E_value: 1e-26
Swissprot: Q04894|ADH6_YEAST
Gene Ontology:
GO:0005625 = Cellular component: soluble fraction
GO:0008106 = Molecular function: alcohol dehydrogenase (NADP+) activity
GO:0033833 = Molecular function: hydroxymethylfurfural reductase (NADH) activity
GO:0033845 = Molecular function: hydroxymethylfurfural reductase (NADPH) activity
GO:0006066 = Biological process: alcohol metabolic process
GO:0033859 = Biological process: furaldehyde metabolic process

Sequence:
>Contig1858
TTGGGGGGACAACTTTGTACAAAAAAGTTGGATCAGTAACTACAAAAAAG
ATAAAATCGACGAAAACAGCGAGAAAGCAAAGCCCAATTCTAAGAAGATG
TCTACAGAATACTCTTTCAAGGGATGGGTTGGTTCGAGCAATGATTGTAT
CGAGAAGCAGAACCTTGTCTATAAGGATATCGAGCCTAAGAGATTCACGG
AGGACGATGTGGATATTCGGATCACCCATTGTGGTATTTGCGGGACTGAC
GTCCACACCCTGACGAACGGCTGGGGCTTCACGAGCTATCCCGTTGTTGT
CGGCCACGAAATCGTCGGCACGGCAGTGAAAGTTGGGAAGAACGTCCAGG
GAATCAAAGTCGGTGACCGGGTCGGTGTAGGTGCACAGGCAAGCTCCTGC
TTGTCGTGCGGTGAGTGCAATGCTGATAATGAATCCTATTGCAAGGACAT
GGTAGGAACCTATAATGGCAAGTACCCCGACGGCAGCATGTCCACTGGTG
GATTCGCCGACTACACTCGTGTTCCTGGCCACTTCGTTTTCAAGATCCCG
GAGGCACTCTCTAGTGAAATCGCTGCGCCCATGCTCTGCGGTGGAATAAC
CATGTTTTCACCC

Sequences in the Contig:

SY0AAA6YM02FM1 SY0AAB44YM08FM1 SY0AAB46YE02FM1