Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1857
Length(NT) : 1043
Best Gene Model Blast : Link to GSTUMT00005343001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein CIMG_08094
Accession: ref|XP_001240931.1| Score: 996 E_value: 1e-106
KEGG Definition: conserved hypothetical protein; K02981 small subunit ribosomal protein S2e
Accession: mgr:MGG_09222 Score: 983 E_value: 1e-105
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0877 Score: 812 E_value: 2e-87
PFAM Definition: Ribosomal_S5, Ribosomal protein S5, N-terminal domain..
Pfam Number: pfam00333 Score: 259 E_value: 3e-23
Swissprot: P25443|RS2_YEAST
Gene Ontology:
GO:0022627 = Cellular component: cytosolic small ribosomal subunit
GO:0032040 = Cellular component: small subunit processome
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0006450 = Biological process: regulation of translational fidelity

Sequence:
>Contig1857
TTGGCTCACCGACTTTCCACAACCTCCCCTTTCTAACAAAACCCAATAAA
AATACCATGGCTGAAGCCCCTGCTGGAGGTGCTCGCGGCGGTGCCGGAGG
ATTCGGAGCTCGCGGAGGAGACCGTGGACGTGGTCGTGGACGTCGTGGTC
CCCGTCGTGGAGCTAAGAGCGAGGAGAAGGAATGGCAACCAGTTACCAAG
CTTGGACGCCTTGTAAAGCTTGGAAAGATAAAGAGCATGGAGGAGATCTA
CCTCCACTCTTTGCCAATCAAGGAGTACCAGATTGTGGACTTTTTCTTGC
CCAAGCTGAAGGATGAGGTTATGAAGATTAAACCTGTCCAGAAGCAAACC
CGTGCCGGTCAGCGTACCCGCTTCAAGGCTATCGTTGTTATCGGCGACAG
CGAAGGGCATGTTGGTCTCGGAATCAAGACCTCCAAGGAAGTCGCTACTG
CTATCCGCGCCGCTATCATCATTGCAAAGCTTTCTGTTCTCCCCATCCGT
CGCGGGTACTGGGGTACCTCCCTCGGAGAGCCACACTCTCTTGCCGCTAA
GGAGTCTGGAAAGTGCGGTTCAGTTACCGTCAGACTGATTCCTGCTCCCC
GTGGAACCGGTCTTGTCGCCTCTCCCGCCGTCAAGCGTCTTCTCCAGCTC
GCCGGTGTCCAGGATGTCTACACAGCCTCCTCAGGATCTACCAAGACACT
CGAGAACACCCTCAAGGCTACCTTTACTGCCGTTGGGAACACTTACGCTT
TCTTGACACCCAACCTCTGGAAGGAGACAAAACTGCTGAGGAGCCCCCTA
GAGGAGTTCGGTGACCAGTTGAAGAGCAAGGAGAGGTATTAAATGTTTTT
CAAAATGGGAATGGGGAGTTTCGATTCTTTGTCATTGTAGGGTTGGGGAT
ATTCAAAAAAAAATCCAAACCACCCGCCGTTTTCCCTCTTCCTTATTCCT
TTTCTCTTTTACTGTGGGACCATGGTGTAAATGTCAAACAAAAATATCGC
TAATACCGGAAACTTGTCGCATTTGATGTGACCACTTTGACCT

Sequences in the Contig:

SY0AAA16YJ15FM1 SY0AAA18YG18RM1 SY0AAA23YD07FM1
SY0AAA30YC08FM1 SY0AAA6YL11FM1 SY0AAA7YI21FM1
SY0AAB19YI15FM1 SY0AAB42YL23FM1 SY0AAC35YL02FM1
SY0AAD13YH09FM1 SY0AAD47YG14FM1 SY0AAD8YA01FM1