Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1856
Length(NT) : 769
Best Gene Model Blast : Link to GSTUMT00004699001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1856
TAACCCTCTCTTTAATTCAGCCACCACAACCGCCAATAACTCGACATTCG
CAAACTCTGTGTTCGACGCCTCAGTCACGATCCCGGATTTCACCAAAGAG
AAAAAGTTCACAGAGTGGCACAAAAAGCAAGGGATCCCGGCTCCTCAGGA
TTATCCTTCGTTTGCAAATCAGCCAGCGCCGTTTTCTGCCCTACGGCAAA
ACCCGAATGTACCGACCGCTGCCTCCTCATATATCCATAAGGTTTCCACT
CTTCAACCCGCGACTGATGCAAGGGCCTCTTTGCTTGAGGCAGATGCACA
TGGTGGCCTTAATGAACCTTTGGAAGGAAGGAGAAAGTCAACACTCAAAA
AGACACTATCGTCATCGCCTCCAGGCTCCCCCAGTGGCCACTGGCCCAGA
AACACCTTTGGATCTCGTCCAATAAGTCGAACACGCAACCGTTCGTCGTC
CATGACAGATGATCAGCCTCTGCATGCTGCCGATACAAATGCGCCTCCTT
TGCTCTCGATATACGATTCCATGCCCTTTGATCCCACTCCGTTGGAGTTA
AAACCCGCCGATGCGACATTTACTCCAACACAAGTTCGGGTCGCAAACTT
TTCCGAAGACAGGTTTCCGGACCTTATTCGTTCGTTACGTCGATACTACG
GAGTTATATTAGAACCTTATTCCGGACTCCCAGCAAACGAGAGCAAGTTT
CATGATCCCGACATTGTTCCGCGTGAACAGTTGGACGCGAAGACATTACG
GAAGACACAGCCTCTTGCG

Sequences in the Contig:

SY0AAA6YL10FM1 SY0AAB36YN22FM1 SY0AAC45YH08FM1