Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1855
Length(NT) : 1733
Best Gene Model Blast : Link to GSTUMT00012250001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: hypothetical protein FG10285.1
Accession: ref|XP_390461.1| Score: 1747 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: fgr:FG10285.1 Score: 1747 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism, Lipid transport and metabolism].
Kog Number: KOG0141 Score: 385 E_value: 1e-37
PFAM Definition: Acyl-CoA_dh_1, Acyl-CoA dehydrogenase, C-terminal domain. C-terminal domain of Acyl-CoA dehydrogenase is an all-alpha, four helical up-and-down bundle..
Pfam Number: pfam00441 Score: 305 E_value: 2e-28
Swissprot: Q8HXY7|ACADV_MACFA
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>Contig1855
TTGGCCTCTCTGCTCAGCTGAGATAGACAGACAGAATCGCAAACTACGGC
AGCAAGCAAGCATGGCCACACAAACCTTCACCCGTGAGCAAGTCTCCAAG
AACAATAATGCCGATTCACTTCACGTTATCATCGACTCCAAGGTTTATGA
CCTGACTGACTTTACCGACGCCCACCCCGGAGGCGTACATGCTCTCTTGC
AAGTCGCGGGACAGGACGCAACATCAGAGTTCTACTCCATGCACCGACAT
GAAATCCTGACAAAGTACGCCAACCTGGTGATCGGGACGATTCAGGGTGA
ATCACCGCAGGTTATCGAGCCGAAGGCAGGAGACTTGTGCCCGATACCTT
ACACCGAGCCTATGTGGTTGAGTCCTGACTTCAAGAGCCCTTATTATGAC
GAGACTCATCGGAGGCTGCAGAAGGAGGTTAGGGTTTTCGTCGACGAGTA
TGTCCGGCCGGAGGCTTTGAGGATTGAAGAGGCTGGAGAGAGGCCGAGTG
CCGAGATCATCAAGCGGATGGCCGAAAACGGTATCAACGCCATGCGCCTC
GGTCCGGGCAGACATCTGGAGGGGTACAACCTGATTGGCGGAATCGAGCC
CAAGGAGTTCAACTACTTCCACGAACTCGTTCTCAACCAAGAACTCGTAC
GAACACACGGACGTGCGTGCAACGACGGCTTCCTCGGCGGTATGGTAATC
GGTCTCCCCCCTGTCCTCAACTTCTGCCGCAACACCGCTCTCCGCGACCG
CGTGATGCGTGAGTGCTTCTCCGGCGAAAAGTCTATCTGTCTCGCTGTGA
GCGAGGCCTTTGCCGGCAGCGACGTCGCCTCCATTCGCACCACCGCGGTA
AAGAGCGCCGATGGGACACACTACGTTGTAAATGGGACCAAGAAGTGGAT
TACGAACGGTAACTGGGCAGATTACTTCACTACGGCGGTCAAGACAGAGA
AGGGCTACAGCATGCTCCTAATCGAGCGCGGAGAAGGCGTGGAAACCGAG
CAGATCAAAACATCGTACTCGTCCGCAGCCGGAACCGCATTCATCACCTT
CGACAACGTCAACGTCCCAGTTGAAAACCTCCTAGGAAAGGAACACCAAG
GTTTCCCGGTTATCATGTCAAACTTCAATCACGAGCGCTGGGTGATGGCC
TGCGCATCCATCCGCGCCTCCCGCGTGGTTGTGGAGGAATGCCTAAAGTG
GGCGAACCAGCGTAAGGTGTTCGGACGACGCCTAGTAGACCAGCCCGTTA
TCCGCGGGAAACTTGCGAAGATGATCTCCCTGGTGGAGTCCGGACAATCC
TGGCTCGAGGCAATTACTTACCAGATGTGCAACATGACCTACCAGCAGCA
GGCAAAGTCCCTCGCTGGGCCGATCGCTCTCTTGAAAAACTTTATCACCC
GCGCCGCGCACGAGATTGCGGACGAGTCGGTTCAGGTGTTTGGCGGGAGG
GGTATTACCAAGTCTGGAATGGGAAGGGTCATCGAGAATTTCCACCGGAC
ATATAAGTTTGATGCAGTTCTCGGAGGGTCCGAAGAAATTCTTGGTGACC
TTGCCGTTCGACAGGCTCTCAAGAATTTTCCAAAGTCGATGTTGTAATCT
CCCCTACCCCCATGCCCTTTCTTGACGTTTTGTAGGATCTCGTCCTGGCT
AGAAGCACTTGCATGCCCTTTCTCGGGGTAGATTTTGACTTGTTCGAAAT
GTTTGTAGTATGATAGAAAATACATCTCTTCTT

Sequences in the Contig:

SY0AAA11YD13FM1 SY0AAA28YO15FM1 SY0AAA41YA12FM1
SY0AAA41YJ03FM1 SY0AAA41YN10FM1 SY0AAA6YK12FM1
SY0AAB47YP03FM1 SY0AAB57YL04FM1 SY0AAC1YM09FM1
SY0AAC24YD07FM1 SY0AAC26YE04FM1 SY0AAC26YE04RM1
SY0AAC30YP07FM1 SY0AAD11YO23FM1 SY0AAD33YC02FM1
SY0AAD35YO24FM1 SY0AAD7YL18FM1