Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1854
Length(NT) : 888
Best Gene Model Blast : Link to GSTUMT00006821001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An11g04780
Accession: ref|XP_001394469.1| Score: 468 E_value: 5e-45
KEGG Definition: hypothetical protein
Accession: ang:An11g04780 Score: 468 E_value: 3e-45
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3860 Score: 194 E_value: 7e-16
PFAM Definition: No Hit Found
Swissprot: Q09758|YA71_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0006506 = Biological process: GPI anchor biosynthetic process

Sequence:
>Contig1854
TTGGAAGCGACAGTGGAAAAGCAAAAGTATATAGTAGCCCCGTCCGAAAT
CCCTTTCTATTTCTTATTGCTACATATCGAGAGAGTTTTCCACCTCTCTC
CCTCCTACACACGCTCCCTTTTGGACAACCAGTTTTGTTGGACCCGTCCC
GCCAGTAGCAGTCATGCTGCGCTTTTCCACTGTCCGCTCCATCTTCTCAC
TAGGCACTCTCGACTCTCGCTTGACTGCGAATACCCCACGATCCTCCTCC
CCTCCTAAAAACCCCGCCACTCCATCTTTAGCGGGAACCGCACGCAATGG
GGAAAGTTCGCGCAGCCAGAAATTGCGCAAGGAGTCCTCGCCGTCGAAAT
GGAGAACCCCCGAGTTCTGCTCATACATCGTCGGTGTGGGAATAGCTGTA
ATCTTAATGTTCAAGACCACTCATGATATAAGTAAAGAATCGCATCCCAA
TTACCCTAAATTCGAGCCCCTTCTTTCCCCCGGCTGGATACCCGGGCGAA
AAGTGGACAACTCTGATCAACAGTACGCCAATTTCCGCGACAACATACCC
ATTCTCGCGGGAGTTCTTATAGGCCATTTCCTCCTGCGCCGAGGCTTCGA
TGTGCTCTCCTCTAGGTTATTTCCCACTCCACCTCTCAATTCCTCGTACC
GCCCGTCACACAACATCAATCGACGAAAGTGCTTCGACATCTTGTTCGCA
GTTATATTTCTTACGGCACTGCACTCGCTCAGTATCATCAAGATTCTCGT
TTTTCTCACCGCGAATTGGCTTATCTCCTTCTTTCACCCCAGCTCTATTT
TTGTGCCAATTTTGACTTGGGGGTTCAACATTGGCGTTCTTTTTGCGAAC
GAGTACTTTGAGGGTTACCACTTCCGCCTCATTCTCCC

Sequences in the Contig:

SY0AAA6YK06FM1 SY0AAB56YE03FM1 SY0AAC59YM13FM1