Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1853
Length(NT) : 1063
Best Gene Model Blast : Link to GSTUMT00002234001 E-value : 0.0
Numbers of ESTs : 59

Blast Results:

Nr Definition: Autophagy-related protein 8 precursor (Autophagy-related ubiquitin-like modifier atg8) sp|A7KAL9|ATG8_PENCH Autophagy-related protein 8 precursor (Autophagy-related ubiquitin-like modifier atg8) dbj|BAE61090.1| unnamed protein product
Accession: sp|Q2UBH5|ATG8_ASPOR Score: 557 E_value: 3e-55
KEGG Definition: hypothetical protein
Accession: ang:An07g10020 Score: 557 E_value: 2e-55
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1654 Score: 523 E_value: 7e-54
PFAM Definition: MAP1_LC3, Microtubule associated protein 1A/1B, light chain 3. Light chain 3 is proposed to function primarily as a subunit of microtubule associated proteins 1A and 1B and that its expression may regulate microtubule binding activity..
Pfam Number: pfam02991 Score: 490 E_value: 5e-50
Swissprot: Q8J282|ATG8_PODAN

Sequence:
>Contig1853
TTGGCCAAGATCTACCATCGCGGTACTCACGCTGTGTGACACTTTCCACC
CCCTTGTCATCACTCATCCCTTCCTCGTAAACCAGTCACAGTACCATTCC
TATCCTATCGACTCACTCCTGTCACCCTTCCCCCCTCATCCCCTTCCTTC
GCTCCTCCCTGCTTCCTTCCCCTCCATCTCATCCATCCCCACCCTTTCTT
TCCGCCTTTCTATTCCTCTGTGGCTGTACTTTGGGGTACATACCGAGGTT
TTTTCTACTCTGCCTCTGCCCTTCTACGAGAGACTCATAGCACGTTTCTG
GATTCTCCAAGAAACGCCTCAGCTGACCCAGCCAATAAATAGCTGCTAGC
TAGCTTCATCTACCCTTATCCTGTGTGTGTCTATCTGATCTGGTCCGATC
GCTGCTCGACCTCTGACTGTTAAGTCAAGTACAAATCTCCTTTCAACAGA
GTTTTCGTAGTTCGTAGTTCAGCAAGTCTTTCAAGATGCGCAGCAAGTTT
AAGGACGAACACACCTTTGAGAAGCGCAAGGCGGAAGCCGAACGCATTCG
CCAGAAATATGCAGACCGTATTCCAGTTATTTGCGAGAAGGTCGAGAAGT
CGGATATTGCAACAATCGATAAGAAGAAGTACCTGGTTCCTGCGGACTTG
ACTGTCGGTCAGTTCGTCTATGTTATCCGCAAACGCATCAAGCTGTCCCC
GGAGAAGGCTATCTTTATCTTTGTTGATGAGGTGCTTCCTCCGACGGCTG
CCCTAATGAGCTCTATTTACGAGGAGCACAAGGACGAGGACGGATTTCTT
TACATAACCTACTCCGGTGAAAACACCTTTGGCTTTGAGGAGCTGTTGTA
AACCGTCGGAGGGAGTTCAGGTGTGGGGGATGGTTTTTGCTTTCATTTGG
GAAAGGCCTGTTGGGTGGGGAGATTGGTTGGTGAAGGTTTTCTTTTTTGG
GAGGAGGTTTTCTGGCGTCGGCCCGAGTCGATAAGCTCTTTCCCATAAAA
AATCACCTCACCCAATGACCCCCAGAAGGGCCCTGTTTTTTTATTTCCTC
TTGTCGAGTGCTT

Sequences in the Contig:

SY0AAA18YN11FM1 SY0AAA1YI21FM1 SY0AAA1YM17FM1
SY0AAA26YJ08FM1 SY0AAA33YP24FM1 SY0AAA38YK02FM1
SY0AAA42YK06FM1 SY0AAA50YB20FM1 SY0AAA52YL04FM1
SY0AAA57YO16FM1 SY0AAA59YK13FM1 SY0AAA63YB23FM1
SY0AAA63YF10FM1 SY0AAA6YG15FM1 SY0AAA6YJ13FM1
SY0AAB11YK13FM1 SY0AAB15YI08FM1 SY0AAB21YE09FM1
SY0AAB27YL22FM1 SY0AAB33YB07FM1 SY0AAB35YJ09FM1
SY0AAB36YA06FM1 SY0AAB37YG20FM1 SY0AAB40YL07FM1
SY0AAB42YA03FM1 SY0AAB4YN20FM1 SY0AAB50YI21FM1
SY0AAB50YI23FM1 SY0AAB50YJ11FM1 SY0AAB51YK07FM1
SY0AAB54YF12FM1 SY0AAB54YG19FM1 SY0AAB55YH18FM1
SY0AAB6YF23FM1 SY0AAC16YG04FM1 SY0AAC18YI20FM1
SY0AAC25YD02FM1 SY0AAC31YH24FM1 SY0AAC32YA16FM1
SY0AAC32YJ16FM1 SY0AAC34YH15FM1 SY0AAC39YA10FM1
SY0AAC3YB12FM1 SY0AAC46YL21FM1 SY0AAC50YB15FM1
SY0AAC52YL08FM1 SY0AAC53YI23FM1 SY0AAC53YP09FM1
SY0AAD13YH15FM1 SY0AAD19YM14FM1 SY0AAD30YG15FM1
SY0AAD35YE12FM1 SY0AAD36YM16FM1 SY0AAD3YF11FM1
SY0AAD51YI21FM1 SY0AAD52YD23FM1 SY0AAD52YK03FM1
SY0AAD62YO01FM1 SY0AAD9YP12FM1