Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1852
Length(NT) : 936
Best Gene Model Blast : Link to GSTUMT00009008001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 345 E_value: 1e-30
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 345 E_value: 5e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1852
TTGGGTAAACCCAACCTTGGCCGATATAAGAAGATATATTGAGAAGAGGT
TGGAAGAGGACTTGGATACGAGCGCAATGAACGATAAATTGCGAGCCGAT
ATATTCAGAGTTGTTCCGGAAAGGGTCTCGGGAATCTTCCTTCTTGCTTG
CATCAATATGGACGCAATCCTTGCAACACCAACCATTCATCAAAAGAGAC
AAGCACTTGGTGGGATGACCAAGGCCTTTGATTTACAGGACGCATATGGC
ACGACATTGGATCGGATAAAGCAGCAGAGTGGAAACAAATCAAAGCTGGG
AATGGAAGCGTTGATGTGGATTTCCTACTGCGAAAGGCCCTTGAATCCCA
AGGAGCTGGGTCATGCCCTGGGGGTAGAACTGGGAGTGAAATAGTTCAAC
ACCCACAATGTTCCTTCGATACGGACCATACTGGACTGCACCTTAGGACT
TGTCATAATTGACGAAAAGGCGTCAACGGTCCGTCGCCTGCATCACACAC
TACAGGAGTATCTTGGAGAACATCCTACCCTATTTGTAACTGCTCGCTCA
ATGATGGCCGAAGTCTGTCTCACCTATATGGACTGTCGGTCCGCTCGGGC
GCTTCCTCCAAAACTGGATATGGCCCTGGCAACAATGCCATTTCTTGAAT
ATGCCACATGTTTCTGGGGAGCTCATGCAGGCAGTGGGGTTACTGAGACG
GTGAAAGCATTGGCATTGCGAGTCCTTGACAGATATGAGAACCATGTATC
TGCCGATATTCTCTGGCGAAAGAAGATACGTAACTCGTACTGGGATGAGG
AGGTTCGGGGGATTAGTGGACTGCACTATATCGCCTTTTGGGGGATCGTA
GAAATTACAATTGCTATGCTGGAGGCGAAAAAATGGGATGTGAATGGGTG
CGATTCTATGGGCGACGCACCATTAACGTGGACTGT

Sequences in the Contig:

SY0AAA6YJ11FM1 SY0AAC12YM12FM1